Mutagenetix > Incidental Mutation

Incidental Mutation 'R3874:Picalm'

276722

Institutional Source

Beutler Lab

Gene Symbol

Picalm

Ensembl Gene

ENSMUSG00000039361

Gene Name

phosphatidylinositol binding clathrin assembly protein

Synonyms

fit-1, fit1

MMRRC Submission

040792-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R3874 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90130213-90213465 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 90189219 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 493 (F493Y)

Ref Sequence

ENSEMBL: ENSMUSP00000147016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049537] [ENSMUST00000207084] [ENSMUST00000207225] [ENSMUST00000207484] [ENSMUST00000208730] [ENSMUST00000208742] [ENSMUST00000209068]

AlphaFold

Q7M6Y3

Predicted Effect

probably damaging
Transcript: ENSMUST00000049537
AA Change: F493Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051092
Gene: ENSMUSG00000039361
AA Change: F493Y

Domain	Start	End	E-Value	Type
ENTH	20	145	2.42e-39	SMART
coiled coil region	317	349	N/A	INTRINSIC
low complexity region	378	387	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000207084
AA Change: F377Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207106

Predicted Effect

probably damaging
Transcript: ENSMUST00000207225
AA Change: F443Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000207484
AA Change: F493Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207822

Predicted Effect

unknown
Transcript: ENSMUST00000208089
AA Change: F218Y

Predicted Effect

probably damaging
Transcript: ENSMUST00000208730
AA Change: F443Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208742
AA Change: F493Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208891

Predicted Effect

probably damaging
Transcript: ENSMUST00000209068
AA Change: F443Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a clathrin assembly protein, which recruits clathrin and adaptor protein complex 2 (AP2) to cell membranes at sites of coated-pit formation and clathrin-vesicle assembly. The protein may be required to determine the amount of membrane to be recycled, possibly by regulating the size of the clathrin cage. The protein is involved in AP2-dependent clathrin-mediated endocytosis at the neuromuscular junction. A chromosomal translocation t(10;11)(p13;q14) leading to the fusion of this gene and the MLLT10 gene is found in acute lymphoblastic leukemia, acute myeloid leukemia and malignant lymphomas. The polymorphisms of this gene are associated with the risk of Alzheimer disease. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for different ENU-induced mutations or knock-out alleles are small, runted and display anemia of variable severity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130213A22Rik	C	A	11: 69,121,475	G26*	probably null	Het
Abca5	T	A	11: 110,310,233	Y447F	probably damaging	Het
Acox2	A	G	14: 8,248,061	I407T	probably benign	Het
Adam8	T	C	7: 139,987,607	N408D	probably damaging	Het
Adgre1	A	T	17: 57,401,925	T39S	probably benign	Het
Akap12	G	A	10: 4,357,590	V1467I	probably benign	Het
Arid1b	T	A	17: 5,336,515		probably null	Het
Atp2c2	A	G	8: 119,735,296	I303V	possibly damaging	Het
Bpifc	C	T	10: 85,991,254	V144I	probably benign	Het
C530008M17Rik	A	G	5: 76,840,892	D30G	probably damaging	Het
Camk4	A	G	18: 33,158,854	E189G	possibly damaging	Het
Casz1	A	G	4: 148,939,589		probably benign	Het
Ccdc134	T	C	15: 82,131,442	V41A	possibly damaging	Het
Chrd	A	T	16: 20,738,910	T753S	probably damaging	Het
Cyb561a3	T	C	19: 10,585,371	V125A	probably benign	Het
D630039A03Rik	T	A	4: 57,910,606	T69S	probably benign	Het
Dchs1	A	G	7: 105,761,635	F1687S	probably damaging	Het
Dlgap4	T	C	2: 156,749,347	S818P	probably benign	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Dnaic2	G	T	11: 114,732,955	G15W	probably damaging	Het
Dsg1c	A	G	18: 20,277,052	I526V	probably benign	Het
Far2	G	A	6: 148,150,591	E123K	probably benign	Het
Gli1	A	T	10: 127,330,219	V1055E	probably damaging	Het
Hand2	G	T	8: 57,321,976	A24S	probably benign	Het
Helb	T	C	10: 120,106,037	I249V	probably benign	Het
Hspa4l	G	A	3: 40,772,642	V492M	probably damaging	Het
Hspg2	T	C	4: 137,539,349	I1916T	probably damaging	Het
Igfals	G	A	17: 24,881,605	V557I	possibly damaging	Het
Itpa	T	G	2: 130,681,010	S176A	probably damaging	Het
Kcnu1	T	A	8: 25,885,317	L353H	probably damaging	Het
Klhl1	A	G	14: 96,518,179	F47L	probably benign	Het
Klhl13	T	C	X: 23,285,176	D21G	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Krt9	C	T	11: 100,190,849	V285I	probably damaging	Het
Mansc1	T	C	6: 134,610,183	R344G	possibly damaging	Het
Mier2	G	T	10: 79,541,797	P439T	possibly damaging	Het
Mppe1	T	A	18: 67,225,886		probably null	Het
Nedd4l	G	A	18: 65,167,535	A243T	probably benign	Het
Notch4	T	A	17: 34,578,069	C934*	probably null	Het
Nsmce3	C	T	7: 64,872,168	D251N	probably damaging	Het
Olfr101	T	A	17: 37,299,979	T148S	probably benign	Het
Olfr1156	T	A	2: 87,949,530	R234S	probably damaging	Het
Olfr1310	T	C	2: 112,008,323	T288A	possibly damaging	Het
Olfr139	A	G	11: 74,044,699	C192R	probably damaging	Het
Olfr517	C	T	7: 108,869,128	V9M	probably damaging	Het
Olfr937	A	G	9: 39,060,174	I164T	probably benign	Het
Pdzd7	T	C	19: 45,045,628	T6A	probably benign	Het
Prl7d1	A	G	13: 27,716,668	M1T	probably null	Het
Prl8a1	T	C	13: 27,575,458	K199E	possibly damaging	Het
Rims1	C	T	1: 22,428,489	R764H	probably damaging	Het
Rnf17	G	T	14: 56,475,413	R779L	possibly damaging	Het
Rufy2	T	C	10: 62,998,137	L294P	probably damaging	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Slc22a30	G	T	19: 8,336,849	T491K	probably benign	Het
Slc35b3	T	C	13: 38,943,068	N20D	possibly damaging	Het
Slc5a4a	T	C	10: 76,181,655	F429L	probably benign	Het
Sulf1	T	C	1: 12,817,412	I270T	probably damaging	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tnc	T	A	4: 64,008,710	I860F	probably damaging	Het
Trh	A	T	6: 92,243,698	V61E	possibly damaging	Het
Ttn	T	G	2: 76,754,099	T22222P	probably damaging	Het
Uroc1	A	T	6: 90,361,512	K652*	probably null	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r120	A	T	17: 57,524,954	F278L	probably benign	Het
Vmn2r7	A	G	3: 64,719,611	F86L	possibly damaging	Het
Vmn2r87	A	T	10: 130,479,987	I70K	possibly damaging	Het
Vps13a	C	T	19: 16,744,953	A332T	probably benign	Het
Zfp568	T	A	7: 30,023,396	C589S	probably damaging	Het

Other mutations in Picalm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01016:Picalm	APN	7	90161318	missense	probably damaging	1.00
IGL01147:Picalm	APN	7	90177592	missense	probably benign	0.42
IGL02814:Picalm	APN	7	90191749	missense	possibly damaging	0.75
IGL02828:Picalm	APN	7	90177501	missense	probably benign
IGL02904:Picalm	APN	7	90176411	splice site	probably benign
IGL02986:Picalm	APN	7	90207585	missense	probably benign	0.00
IGL03001:Picalm	APN	7	90182246	missense	probably benign	0.00
IGL03247:Picalm	APN	7	90194291	missense	probably benign	0.27
R0024:Picalm	UTSW	7	90130704	critical splice donor site	probably null
R0085:Picalm	UTSW	7	90182317	missense	probably benign
R0414:Picalm	UTSW	7	90189198	missense	possibly damaging	0.94
R0537:Picalm	UTSW	7	90130668	missense	probably benign	0.05
R0855:Picalm	UTSW	7	90191148	missense	possibly damaging	0.55
R1269:Picalm	UTSW	7	90165549	nonsense	probably null
R1496:Picalm	UTSW	7	90130651	missense	probably benign	0.36
R1635:Picalm	UTSW	7	90191251	missense	probably damaging	1.00
R1750:Picalm	UTSW	7	90191182	missense	possibly damaging	0.81
R1755:Picalm	UTSW	7	90160549	missense	possibly damaging	0.88
R2513:Picalm	UTSW	7	90197009	missense	probably damaging	1.00
R3850:Picalm	UTSW	7	90191704	missense	probably damaging	1.00
R5095:Picalm	UTSW	7	90170633	missense	probably damaging	1.00
R5368:Picalm	UTSW	7	90207595	makesense	probably null
R5517:Picalm	UTSW	7	90170598	missense	possibly damaging	0.68
R6012:Picalm	UTSW	7	90195700	missense	probably benign
R6280:Picalm	UTSW	7	90177562	missense	probably benign	0.00
R6739:Picalm	UTSW	7	90176708	missense	probably damaging	1.00
R6951:Picalm	UTSW	7	90191375	missense	probably damaging	1.00
R7083:Picalm	UTSW	7	90176768	missense	probably benign	0.01
R7877:Picalm	UTSW	7	90130668	missense	probably benign	0.05
R8081:Picalm	UTSW	7	90191243	nonsense	probably null
R9335:Picalm	UTSW	7	90176283	missense	probably benign
R9524:Picalm	UTSW	7	90161276	nonsense	probably null
Z1176:Picalm	UTSW	7	90196967	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGAGGATCACTTGGACAACAATG -3'
(R):5'- AAGTTCTCATCAAGTGATTTGGGG -3'

Sequencing Primer
(F):5'- GATCACTTGGACAACAATGTGATAG -3'
(R):5'- TTGGGGGAAGAAGATCAATTTCTC -3'

Posted On

2015-04-06