Incidental Mutation 'R3874:Adam8'
ID 276726
Institutional Source Beutler Lab
Gene Symbol Adam8
Ensembl Gene ENSMUSG00000025473
Gene Name a disintegrin and metallopeptidase domain 8
Synonyms E430039A18Rik, CD156a, CD156, MS2
MMRRC Submission 040792-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3874 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 139558845-139572475 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139567520 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 408 (N408D)
Ref Sequence ENSEMBL: ENSMUSP00000101684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000106069] [ENSMUST00000148670] [ENSMUST00000173209]
AlphaFold Q05910
Predicted Effect probably damaging
Transcript: ENSMUST00000026546
AA Change: N407D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473
AA Change: N407D

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 5.9e-35 PFAM
Pfam:Reprolysin_5 193 371 1e-22 PFAM
Pfam:Reprolysin_4 193 384 1.7e-16 PFAM
Pfam:Reprolysin 195 394 2.7e-70 PFAM
Pfam:Reprolysin_2 214 384 1.6e-16 PFAM
Pfam:Reprolysin_3 218 339 4.9e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 606 2.15e-35 SMART
EGF 613 642 3.06e-1 SMART
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 732 762 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
low complexity region 784 812 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106069
AA Change: N408D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473
AA Change: N408D

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 152 4e-30 PFAM
Pfam:Reprolysin_5 194 372 9.6e-23 PFAM
Pfam:Reprolysin_4 194 385 1.6e-16 PFAM
Pfam:Reprolysin 196 395 2.2e-73 PFAM
Pfam:Reprolysin_2 215 385 2.9e-18 PFAM
Pfam:Reprolysin_3 219 340 6.6e-21 PFAM
DISIN 412 487 5.16e-36 SMART
ACR 488 607 2.15e-35 SMART
EGF 614 643 3.06e-1 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 733 763 N/A INTRINSIC
low complexity region 771 784 N/A INTRINSIC
low complexity region 785 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128332
Predicted Effect probably damaging
Transcript: ENSMUST00000148670
AA Change: N407D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117858
Gene: ENSMUSG00000025473
AA Change: N407D

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 1.8e-35 PFAM
Pfam:Reprolysin_5 193 371 3.6e-23 PFAM
Pfam:Reprolysin_4 193 384 6e-17 PFAM
Pfam:Reprolysin 195 394 8.2e-71 PFAM
Pfam:Reprolysin_2 214 384 5.8e-17 PFAM
Pfam:Reprolysin_3 218 339 1.7e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 612 2.21e-32 SMART
EGF 619 648 3.06e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156647
Predicted Effect probably benign
Transcript: ENSMUST00000173209
SMART Domains Protein: ENSMUSP00000133673
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185038
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Adam family of proteins that contain the disintegrin and metalloprotease domains. The encoded protein is localized to the cell surface, where it is involved in the remodeling of extracellular matrix and cell migration. Mice lacking the encoded protein display persistent inflammation upon treatment with allergens. Alternative splicing of this gene results in multiple variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological or pathological abnormalities. Mice homozygous for a different knock-out allele exhibit reduced osteoclast differentiation and calvarial fibrosis in response to TNF-alpha treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,012,301 (GRCm39) G26* probably null Het
Abca5 T A 11: 110,201,059 (GRCm39) Y447F probably damaging Het
Acox2 A G 14: 8,248,061 (GRCm38) I407T probably benign Het
Adgre1 A T 17: 57,708,925 (GRCm39) T39S probably benign Het
Akap12 G A 10: 4,307,590 (GRCm39) V1467I probably benign Het
Arid1b T A 17: 5,386,790 (GRCm39) probably null Het
Atp2c2 A G 8: 120,462,035 (GRCm39) I303V possibly damaging Het
Bpifc C T 10: 85,827,118 (GRCm39) V144I probably benign Het
Camk4 A G 18: 33,291,907 (GRCm39) E189G possibly damaging Het
Casz1 A G 4: 149,024,046 (GRCm39) probably benign Het
Ccdc134 T C 15: 82,015,643 (GRCm39) V41A possibly damaging Het
Chrd A T 16: 20,557,660 (GRCm39) T753S probably damaging Het
Cracd A G 5: 76,988,739 (GRCm39) D30G probably damaging Het
Cyb561a3 T C 19: 10,562,735 (GRCm39) V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 (GRCm39) T69S probably benign Het
Dchs1 A G 7: 105,410,842 (GRCm39) F1687S probably damaging Het
Dlgap4 T C 2: 156,591,267 (GRCm39) S818P probably benign Het
Dnah2 A G 11: 69,320,174 (GRCm39) I3965T probably damaging Het
Dnai2 G T 11: 114,623,781 (GRCm39) G15W probably damaging Het
Dsg1c A G 18: 20,410,109 (GRCm39) I526V probably benign Het
Far2 G A 6: 148,052,089 (GRCm39) E123K probably benign Het
Gli1 A T 10: 127,166,088 (GRCm39) V1055E probably damaging Het
Hand2 G T 8: 57,775,011 (GRCm39) A24S probably benign Het
Helb T C 10: 119,941,942 (GRCm39) I249V probably benign Het
Hspa4l G A 3: 40,727,074 (GRCm39) V492M probably damaging Het
Hspg2 T C 4: 137,266,660 (GRCm39) I1916T probably damaging Het
Igfals G A 17: 25,100,579 (GRCm39) V557I possibly damaging Het
Itpa T G 2: 130,522,930 (GRCm39) S176A probably damaging Het
Kcnu1 T A 8: 26,375,345 (GRCm39) L353H probably damaging Het
Klhl1 A G 14: 96,755,615 (GRCm39) F47L probably benign Het
Klhl13 T C X: 23,151,415 (GRCm39) D21G probably benign Het
Krt26 T C 11: 99,225,570 (GRCm39) K304E probably damaging Het
Krt9 C T 11: 100,081,675 (GRCm39) V285I probably damaging Het
Mansc1 T C 6: 134,587,146 (GRCm39) R344G possibly damaging Het
Mier2 G T 10: 79,377,631 (GRCm39) P439T possibly damaging Het
Mppe1 T A 18: 67,358,957 (GRCm39) probably null Het
Nedd4l G A 18: 65,300,606 (GRCm39) A243T probably benign Het
Notch4 T A 17: 34,797,043 (GRCm39) C934* probably null Het
Nsmce3 C T 7: 64,521,916 (GRCm39) D251N probably damaging Het
Or10a49 C T 7: 108,468,335 (GRCm39) V9M probably damaging Het
Or12d12 T A 17: 37,610,870 (GRCm39) T148S probably benign Het
Or3a10 A G 11: 73,935,525 (GRCm39) C192R probably damaging Het
Or4f6 T C 2: 111,838,668 (GRCm39) T288A possibly damaging Het
Or5l13 T A 2: 87,779,874 (GRCm39) R234S probably damaging Het
Or8g23 A G 9: 38,971,470 (GRCm39) I164T probably benign Het
Pdzd7 T C 19: 45,034,067 (GRCm39) T6A probably benign Het
Picalm T A 7: 89,838,427 (GRCm39) F493Y probably damaging Het
Prl7d1 A G 13: 27,900,651 (GRCm39) M1T probably null Het
Prl8a1 T C 13: 27,759,441 (GRCm39) K199E possibly damaging Het
Rims1 C T 1: 22,498,740 (GRCm39) R764H probably damaging Het
Rnf17 G T 14: 56,712,870 (GRCm39) R779L possibly damaging Het
Rufy2 T C 10: 62,833,916 (GRCm39) L294P probably damaging Het
Sgsh A G 11: 119,241,773 (GRCm39) L111P probably damaging Het
Slc22a30 G T 19: 8,314,213 (GRCm39) T491K probably benign Het
Slc35b3 T C 13: 39,127,044 (GRCm39) N20D possibly damaging Het
Slc5a4a T C 10: 76,017,489 (GRCm39) F429L probably benign Het
Sulf1 T C 1: 12,887,636 (GRCm39) I270T probably damaging Het
Tmem51 T C 4: 141,759,059 (GRCm39) T230A probably damaging Het
Tnc T A 4: 63,926,947 (GRCm39) I860F probably damaging Het
Trh A T 6: 92,220,679 (GRCm39) V61E possibly damaging Het
Ttn T G 2: 76,584,443 (GRCm39) T22222P probably damaging Het
Uroc1 A T 6: 90,338,494 (GRCm39) K652* probably null Het
Usp34 C T 11: 23,439,033 (GRCm39) P3532S possibly damaging Het
Vmn2r120 A T 17: 57,831,954 (GRCm39) F278L probably benign Het
Vmn2r7 A G 3: 64,627,032 (GRCm39) F86L possibly damaging Het
Vmn2r87 A T 10: 130,315,856 (GRCm39) I70K possibly damaging Het
Vps13a C T 19: 16,722,317 (GRCm39) A332T probably benign Het
Zfp568 T A 7: 29,722,821 (GRCm39) C589S probably damaging Het
Other mutations in Adam8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Adam8 APN 7 139,567,158 (GRCm39) missense probably damaging 1.00
IGL02044:Adam8 APN 7 139,562,735 (GRCm39) missense possibly damaging 0.85
IGL02228:Adam8 APN 7 139,568,719 (GRCm39) splice site probably null
IGL02257:Adam8 APN 7 139,567,561 (GRCm39) missense possibly damaging 0.88
IGL03101:Adam8 APN 7 139,568,456 (GRCm39) missense possibly damaging 0.56
R0320:Adam8 UTSW 7 139,566,355 (GRCm39) missense probably damaging 1.00
R0384:Adam8 UTSW 7 139,566,725 (GRCm39) unclassified probably benign
R1169:Adam8 UTSW 7 139,563,842 (GRCm39) missense probably benign 0.11
R1340:Adam8 UTSW 7 139,571,290 (GRCm39) missense probably damaging 0.99
R1699:Adam8 UTSW 7 139,563,224 (GRCm39) missense possibly damaging 0.72
R3725:Adam8 UTSW 7 139,563,781 (GRCm39) missense possibly damaging 0.63
R4716:Adam8 UTSW 7 139,563,851 (GRCm39) missense probably benign 0.31
R4754:Adam8 UTSW 7 139,564,693 (GRCm39) missense possibly damaging 0.87
R4907:Adam8 UTSW 7 139,569,286 (GRCm39) missense probably benign 0.03
R5345:Adam8 UTSW 7 139,567,552 (GRCm39) missense probably benign 0.03
R5579:Adam8 UTSW 7 139,568,897 (GRCm39) missense probably benign 0.03
R5696:Adam8 UTSW 7 139,569,159 (GRCm39) missense probably benign 0.03
R5805:Adam8 UTSW 7 139,565,794 (GRCm39) missense probably damaging 1.00
R5948:Adam8 UTSW 7 139,567,797 (GRCm39) missense probably benign 0.07
R5991:Adam8 UTSW 7 139,570,200 (GRCm39) missense probably damaging 1.00
R6280:Adam8 UTSW 7 139,564,720 (GRCm39) missense probably damaging 0.99
R6456:Adam8 UTSW 7 139,566,701 (GRCm39) missense possibly damaging 0.96
R7098:Adam8 UTSW 7 139,559,412 (GRCm39) missense possibly damaging 0.53
R7105:Adam8 UTSW 7 139,569,968 (GRCm39) missense probably benign 0.00
R7334:Adam8 UTSW 7 139,568,903 (GRCm39) missense probably damaging 1.00
R7342:Adam8 UTSW 7 139,566,304 (GRCm39) missense probably benign 0.00
R7382:Adam8 UTSW 7 139,570,020 (GRCm39) missense possibly damaging 0.74
R7425:Adam8 UTSW 7 139,572,394 (GRCm39) unclassified probably benign
R7507:Adam8 UTSW 7 139,567,091 (GRCm39) critical splice donor site probably null
R7637:Adam8 UTSW 7 139,565,343 (GRCm39) missense probably damaging 0.98
R7904:Adam8 UTSW 7 139,567,591 (GRCm39) missense probably benign 0.17
R8024:Adam8 UTSW 7 139,567,489 (GRCm39) missense probably damaging 1.00
R8176:Adam8 UTSW 7 139,568,786 (GRCm39) missense probably benign 0.03
R8438:Adam8 UTSW 7 139,565,249 (GRCm39) critical splice donor site probably null
R8439:Adam8 UTSW 7 139,567,762 (GRCm39) missense probably benign 0.25
R9077:Adam8 UTSW 7 139,567,552 (GRCm39) missense probably benign 0.03
R9312:Adam8 UTSW 7 139,565,791 (GRCm39) missense probably damaging 1.00
R9346:Adam8 UTSW 7 139,567,634 (GRCm39) missense probably benign 0.00
R9566:Adam8 UTSW 7 139,565,285 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATCCCTTATAGGTTATTCGGGG -3'
(R):5'- ACGTGGCTCTTCCTAACGTG -3'

Sequencing Primer
(F):5'- TAGTGACTTATGACCTCAAGGGCC -3'
(R):5'- GTGGACATCCTTACCCATAGC -3'
Posted On 2015-04-06