Incidental Mutation 'R3874:Hand2'
ID 276728
Institutional Source Beutler Lab
Gene Symbol Hand2
Ensembl Gene ENSMUSG00000038193
Gene Name heart and neural crest derivatives expressed 2
Synonyms Thing2, dHAND, Hed, Ehand2, bHLHa26
MMRRC Submission 040792-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3874 (G1)
Quality Score 108
Status Not validated
Chromosome 8
Chromosomal Location 57774018-57777552 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 57775011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 24 (A24S)
Ref Sequence ENSEMBL: ENSMUSP00000044983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040104]
AlphaFold Q61039
Predicted Effect probably benign
Transcript: ENSMUST00000040104
AA Change: A24S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000044983
Gene: ENSMUSG00000038193
AA Change: A24S

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
low complexity region 21 32 N/A INTRINSIC
low complexity region 81 102 N/A INTRINSIC
HLH 105 157 3.91e-17 SMART
low complexity region 172 184 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225650
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, this transcription factor plays an important role in limb and branchial arch development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants have defects of the neural crest component of branchial and aortic arches and die from heart failure at embryonic day 10.5. Targeted branchial arch specific enhancer mutants show craniofacial defects and die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,012,301 (GRCm39) G26* probably null Het
Abca5 T A 11: 110,201,059 (GRCm39) Y447F probably damaging Het
Acox2 A G 14: 8,248,061 (GRCm38) I407T probably benign Het
Adam8 T C 7: 139,567,520 (GRCm39) N408D probably damaging Het
Adgre1 A T 17: 57,708,925 (GRCm39) T39S probably benign Het
Akap12 G A 10: 4,307,590 (GRCm39) V1467I probably benign Het
Arid1b T A 17: 5,386,790 (GRCm39) probably null Het
Atp2c2 A G 8: 120,462,035 (GRCm39) I303V possibly damaging Het
Bpifc C T 10: 85,827,118 (GRCm39) V144I probably benign Het
Camk4 A G 18: 33,291,907 (GRCm39) E189G possibly damaging Het
Casz1 A G 4: 149,024,046 (GRCm39) probably benign Het
Ccdc134 T C 15: 82,015,643 (GRCm39) V41A possibly damaging Het
Chrd A T 16: 20,557,660 (GRCm39) T753S probably damaging Het
Cracd A G 5: 76,988,739 (GRCm39) D30G probably damaging Het
Cyb561a3 T C 19: 10,562,735 (GRCm39) V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 (GRCm39) T69S probably benign Het
Dchs1 A G 7: 105,410,842 (GRCm39) F1687S probably damaging Het
Dlgap4 T C 2: 156,591,267 (GRCm39) S818P probably benign Het
Dnah2 A G 11: 69,320,174 (GRCm39) I3965T probably damaging Het
Dnai2 G T 11: 114,623,781 (GRCm39) G15W probably damaging Het
Dsg1c A G 18: 20,410,109 (GRCm39) I526V probably benign Het
Far2 G A 6: 148,052,089 (GRCm39) E123K probably benign Het
Gli1 A T 10: 127,166,088 (GRCm39) V1055E probably damaging Het
Helb T C 10: 119,941,942 (GRCm39) I249V probably benign Het
Hspa4l G A 3: 40,727,074 (GRCm39) V492M probably damaging Het
Hspg2 T C 4: 137,266,660 (GRCm39) I1916T probably damaging Het
Igfals G A 17: 25,100,579 (GRCm39) V557I possibly damaging Het
Itpa T G 2: 130,522,930 (GRCm39) S176A probably damaging Het
Kcnu1 T A 8: 26,375,345 (GRCm39) L353H probably damaging Het
Klhl1 A G 14: 96,755,615 (GRCm39) F47L probably benign Het
Klhl13 T C X: 23,151,415 (GRCm39) D21G probably benign Het
Krt26 T C 11: 99,225,570 (GRCm39) K304E probably damaging Het
Krt9 C T 11: 100,081,675 (GRCm39) V285I probably damaging Het
Mansc1 T C 6: 134,587,146 (GRCm39) R344G possibly damaging Het
Mier2 G T 10: 79,377,631 (GRCm39) P439T possibly damaging Het
Mppe1 T A 18: 67,358,957 (GRCm39) probably null Het
Nedd4l G A 18: 65,300,606 (GRCm39) A243T probably benign Het
Notch4 T A 17: 34,797,043 (GRCm39) C934* probably null Het
Nsmce3 C T 7: 64,521,916 (GRCm39) D251N probably damaging Het
Or10a49 C T 7: 108,468,335 (GRCm39) V9M probably damaging Het
Or12d12 T A 17: 37,610,870 (GRCm39) T148S probably benign Het
Or3a10 A G 11: 73,935,525 (GRCm39) C192R probably damaging Het
Or4f6 T C 2: 111,838,668 (GRCm39) T288A possibly damaging Het
Or5l13 T A 2: 87,779,874 (GRCm39) R234S probably damaging Het
Or8g23 A G 9: 38,971,470 (GRCm39) I164T probably benign Het
Pdzd7 T C 19: 45,034,067 (GRCm39) T6A probably benign Het
Picalm T A 7: 89,838,427 (GRCm39) F493Y probably damaging Het
Prl7d1 A G 13: 27,900,651 (GRCm39) M1T probably null Het
Prl8a1 T C 13: 27,759,441 (GRCm39) K199E possibly damaging Het
Rims1 C T 1: 22,498,740 (GRCm39) R764H probably damaging Het
Rnf17 G T 14: 56,712,870 (GRCm39) R779L possibly damaging Het
Rufy2 T C 10: 62,833,916 (GRCm39) L294P probably damaging Het
Sgsh A G 11: 119,241,773 (GRCm39) L111P probably damaging Het
Slc22a30 G T 19: 8,314,213 (GRCm39) T491K probably benign Het
Slc35b3 T C 13: 39,127,044 (GRCm39) N20D possibly damaging Het
Slc5a4a T C 10: 76,017,489 (GRCm39) F429L probably benign Het
Sulf1 T C 1: 12,887,636 (GRCm39) I270T probably damaging Het
Tmem51 T C 4: 141,759,059 (GRCm39) T230A probably damaging Het
Tnc T A 4: 63,926,947 (GRCm39) I860F probably damaging Het
Trh A T 6: 92,220,679 (GRCm39) V61E possibly damaging Het
Ttn T G 2: 76,584,443 (GRCm39) T22222P probably damaging Het
Uroc1 A T 6: 90,338,494 (GRCm39) K652* probably null Het
Usp34 C T 11: 23,439,033 (GRCm39) P3532S possibly damaging Het
Vmn2r120 A T 17: 57,831,954 (GRCm39) F278L probably benign Het
Vmn2r7 A G 3: 64,627,032 (GRCm39) F86L possibly damaging Het
Vmn2r87 A T 10: 130,315,856 (GRCm39) I70K possibly damaging Het
Vps13a C T 19: 16,722,317 (GRCm39) A332T probably benign Het
Zfp568 T A 7: 29,722,821 (GRCm39) C589S probably damaging Het
Other mutations in Hand2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5287:Hand2 UTSW 8 57,775,080 (GRCm39) missense probably damaging 0.98
R6534:Hand2 UTSW 8 57,775,071 (GRCm39) missense probably benign 0.19
R7552:Hand2 UTSW 8 57,775,272 (GRCm39) missense probably damaging 1.00
R8245:Hand2 UTSW 8 57,774,994 (GRCm39) missense probably damaging 0.99
R8428:Hand2 UTSW 8 57,775,461 (GRCm39) missense probably benign 0.00
R8730:Hand2 UTSW 8 57,775,468 (GRCm39) missense probably benign 0.00
R9077:Hand2 UTSW 8 57,776,836 (GRCm39) missense probably damaging 0.99
Z1177:Hand2 UTSW 8 57,775,048 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCATCTTCGGAGTCAGGAGTCC -3'
(R):5'- ATAATGGGAGTGGTCCAGGC -3'

Sequencing Primer
(F):5'- AGTCAGGAGTCCCGTGG -3'
(R):5'- ATAAGCCAGCCGTGGAA -3'
Posted On 2015-04-06