Incidental Mutation 'R3874:Hand2'
ID 276728
Institutional Source Beutler Lab
Gene Symbol Hand2
Ensembl Gene ENSMUSG00000038193
Gene Name heart and neural crest derivatives expressed 2
Synonyms Ehand2, bHLHa26, Thing2, Hed, dHAND
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3874 (G1)
Quality Score 108
Status Not validated
Chromosome 8
Chromosomal Location 57320983-57324633 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 57321976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 24 (A24S)
Ref Sequence ENSEMBL: ENSMUSP00000044983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040104]
AlphaFold Q61039
Predicted Effect probably benign
Transcript: ENSMUST00000040104
AA Change: A24S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000044983
Gene: ENSMUSG00000038193
AA Change: A24S

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
low complexity region 21 32 N/A INTRINSIC
low complexity region 81 102 N/A INTRINSIC
HLH 105 157 3.91e-17 SMART
low complexity region 172 184 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225650
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, this transcription factor plays an important role in limb and branchial arch development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants have defects of the neural crest component of branchial and aortic arches and die from heart failure at embryonic day 10.5. Targeted branchial arch specific enhancer mutants show craniofacial defects and die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Hand2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5287:Hand2 UTSW 8 57322045 missense probably damaging 0.98
R6534:Hand2 UTSW 8 57322036 missense probably benign 0.19
R7552:Hand2 UTSW 8 57322237 missense probably damaging 1.00
R8245:Hand2 UTSW 8 57321959 missense probably damaging 0.99
R8428:Hand2 UTSW 8 57322426 missense probably benign 0.00
R8730:Hand2 UTSW 8 57322433 missense probably benign 0.00
R9077:Hand2 UTSW 8 57323801 missense probably damaging 0.99
Z1177:Hand2 UTSW 8 57322013 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCATCTTCGGAGTCAGGAGTCC -3'
(R):5'- ATAATGGGAGTGGTCCAGGC -3'

Sequencing Primer
(F):5'- AGTCAGGAGTCCCGTGG -3'
(R):5'- ATAAGCCAGCCGTGGAA -3'
Posted On 2015-04-06