Incidental Mutation 'R3874:Mier2'
ID 276734
Institutional Source Beutler Lab
Gene Symbol Mier2
Ensembl Gene ENSMUSG00000042570
Gene Name MIER family member 2
Synonyms
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock # R3874 (G1)
Quality Score 172
Status Not validated
Chromosome 10
Chromosomal Location 79540245-79555199 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 79541797 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 439 (P439T)
Ref Sequence ENSEMBL: ENSMUSP00000059864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062855] [ENSMUST00000165028] [ENSMUST00000172158]
AlphaFold Q3U3N0
Predicted Effect possibly damaging
Transcript: ENSMUST00000062855
AA Change: P439T

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059864
Gene: ENSMUSG00000042570
AA Change: P439T

DomainStartEndE-ValueType
ELM2 194 246 1.46e-9 SMART
SANT 295 344 6.01e-8 SMART
low complexity region 441 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165028
AA Change: P441T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000127387
Gene: ENSMUSG00000042570
AA Change: P441T

DomainStartEndE-ValueType
ELM2 196 248 1.46e-9 SMART
SANT 297 346 6.01e-8 SMART
low complexity region 443 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170950
Predicted Effect probably benign
Transcript: ENSMUST00000172158
SMART Domains Protein: ENSMUSP00000129732
Gene: ENSMUSG00000042570

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Mier2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Mier2 APN 10 79541180 makesense probably null
IGL01761:Mier2 APN 10 79548352 critical splice donor site probably null
IGL01845:Mier2 APN 10 79549584 missense possibly damaging 0.69
IGL02336:Mier2 APN 10 79548350 unclassified probably benign
IGL02882:Mier2 APN 10 79547721 missense probably damaging 1.00
IGL02902:Mier2 APN 10 79549622 missense probably damaging 1.00
R0325:Mier2 UTSW 10 79542596 critical splice donor site probably null
R0972:Mier2 UTSW 10 79544621 unclassified probably benign
R1326:Mier2 UTSW 10 79544709 missense probably damaging 1.00
R1333:Mier2 UTSW 10 79545157 missense probably benign 0.03
R1721:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R1867:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R1868:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R2015:Mier2 UTSW 10 79541202 splice site probably null
R2273:Mier2 UTSW 10 79544534 missense probably damaging 1.00
R2274:Mier2 UTSW 10 79544534 missense probably damaging 1.00
R3729:Mier2 UTSW 10 79545042 unclassified probably benign
R3881:Mier2 UTSW 10 79548750 splice site probably null
R4755:Mier2 UTSW 10 79549197 missense probably damaging 1.00
R4758:Mier2 UTSW 10 79550348 missense probably damaging 1.00
R5070:Mier2 UTSW 10 79549577 missense probably benign 0.03
R6282:Mier2 UTSW 10 79544742 missense probably damaging 1.00
R6785:Mier2 UTSW 10 79544713 missense probably damaging 1.00
R6861:Mier2 UTSW 10 79541156 start gained probably benign
R6869:Mier2 UTSW 10 79542669 missense probably damaging 0.99
R6897:Mier2 UTSW 10 79544739 missense probably damaging 0.99
R6902:Mier2 UTSW 10 79540839 utr 3 prime probably benign
R6946:Mier2 UTSW 10 79540839 utr 3 prime probably benign
R6968:Mier2 UTSW 10 79540642 utr 3 prime probably benign
R6971:Mier2 UTSW 10 79542429 missense possibly damaging 0.53
R7072:Mier2 UTSW 10 79540299 missense unknown
R7350:Mier2 UTSW 10 79540298 missense unknown
R7443:Mier2 UTSW 10 79540455 missense unknown
R7506:Mier2 UTSW 10 79550342 missense probably benign 0.14
R7545:Mier2 UTSW 10 79541194 missense possibly damaging 0.79
R7625:Mier2 UTSW 10 79542709 missense probably damaging 1.00
R7669:Mier2 UTSW 10 79549676 missense probably damaging 1.00
R7895:Mier2 UTSW 10 79541885 start gained probably benign
R8494:Mier2 UTSW 10 79541712 missense probably damaging 1.00
R8520:Mier2 UTSW 10 79542429 missense possibly damaging 0.53
R8834:Mier2 UTSW 10 79550459 missense unknown
R8978:Mier2 UTSW 10 79540956 missense unknown
R9005:Mier2 UTSW 10 79548440 missense probably damaging 0.99
R9007:Mier2 UTSW 10 79548440 missense probably damaging 0.99
R9008:Mier2 UTSW 10 79548440 missense probably damaging 0.99
R9018:Mier2 UTSW 10 79548440 missense probably damaging 0.99
R9051:Mier2 UTSW 10 79548440 missense probably damaging 0.99
R9052:Mier2 UTSW 10 79548440 missense probably damaging 0.99
R9108:Mier2 UTSW 10 79541922 missense probably benign 0.01
R9121:Mier2 UTSW 10 79541760 missense
R9281:Mier2 UTSW 10 79542460 missense probably benign 0.06
Z1176:Mier2 UTSW 10 79540501 missense unknown
Z1177:Mier2 UTSW 10 79540461 missense unknown
Predicted Primers PCR Primer
(F):5'- AAATTCAGTGACCGACAAGGC -3'
(R):5'- CGCCTAAGTGAGATCTGAGAGG -3'

Sequencing Primer
(F):5'- ACAAGGCCACCTGTGCTG -3'
(R):5'- AGGAGCTGAGCCTCTGC -3'
Posted On 2015-04-06