Incidental Mutation 'R3874:Vmn2r87'
ID 276738
Institutional Source Beutler Lab
Gene Symbol Vmn2r87
Ensembl Gene ENSMUSG00000091511
Gene Name vomeronasal 2, receptor 87
Synonyms EG625131
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R3874 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 130471332-130497379 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 130479987 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 70 (I70K)
Ref Sequence ENSEMBL: ENSMUSP00000129215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164227]
AlphaFold E9PZX4
Predicted Effect possibly damaging
Transcript: ENSMUST00000164227
AA Change: I70K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129215
Gene: ENSMUSG00000091511
AA Change: I70K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 422 1.8e-27 PFAM
Pfam:NCD3G 508 562 1.8e-19 PFAM
Pfam:7tm_3 595 829 8.8e-55 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Vmn2r87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r87 APN 10 130497378 start codon destroyed probably null 1.00
IGL01295:Vmn2r87 APN 10 130472009 missense probably damaging 1.00
IGL01411:Vmn2r87 APN 10 130472560 missense probably benign 0.03
IGL01680:Vmn2r87 APN 10 130479717 nonsense probably null
IGL01822:Vmn2r87 APN 10 130472122 missense probably damaging 1.00
IGL01835:Vmn2r87 APN 10 130479109 missense probably damaging 1.00
IGL01965:Vmn2r87 APN 10 130479055 missense possibly damaging 0.49
IGL02562:Vmn2r87 APN 10 130478644 missense probably damaging 1.00
IGL02665:Vmn2r87 APN 10 130497180 missense probably benign 0.16
IGL03202:Vmn2r87 APN 10 130497222 missense probably benign
FR4304:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4340:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4342:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4589:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
LCD18:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
R0344:Vmn2r87 UTSW 10 130479937 missense probably damaging 1.00
R0374:Vmn2r87 UTSW 10 130471979 missense probably damaging 1.00
R0384:Vmn2r87 UTSW 10 130471843 missense probably benign
R1144:Vmn2r87 UTSW 10 130476229 splice site probably benign
R1172:Vmn2r87 UTSW 10 130477584 missense probably benign 0.03
R1860:Vmn2r87 UTSW 10 130479886 missense probably benign 0.00
R1866:Vmn2r87 UTSW 10 130472572 missense possibly damaging 0.88
R1897:Vmn2r87 UTSW 10 130471960 missense probably damaging 1.00
R2360:Vmn2r87 UTSW 10 130479762 missense probably damaging 0.99
R2909:Vmn2r87 UTSW 10 130478996 missense probably damaging 0.99
R4113:Vmn2r87 UTSW 10 130479822 missense probably benign
R4190:Vmn2r87 UTSW 10 130472687 missense probably damaging 1.00
R4197:Vmn2r87 UTSW 10 130479910 missense possibly damaging 0.55
R4201:Vmn2r87 UTSW 10 130472579 missense probably benign 0.03
R4202:Vmn2r87 UTSW 10 130472579 missense probably benign 0.03
R4368:Vmn2r87 UTSW 10 130479807 missense probably benign 0.44
R4485:Vmn2r87 UTSW 10 130479809 nonsense probably null
R4537:Vmn2r87 UTSW 10 130472185 missense probably benign 0.12
R4590:Vmn2r87 UTSW 10 130479145 missense possibly damaging 0.69
R4752:Vmn2r87 UTSW 10 130478467 nonsense probably null
R4873:Vmn2r87 UTSW 10 130472498 missense probably damaging 1.00
R4875:Vmn2r87 UTSW 10 130472498 missense probably damaging 1.00
R4923:Vmn2r87 UTSW 10 130478566 missense probably damaging 0.99
R4970:Vmn2r87 UTSW 10 130478553 missense probably damaging 1.00
R5049:Vmn2r87 UTSW 10 130472429 missense probably damaging 0.96
R5112:Vmn2r87 UTSW 10 130478553 missense probably damaging 1.00
R5187:Vmn2r87 UTSW 10 130497339 missense probably null 0.99
R5618:Vmn2r87 UTSW 10 130479948 missense probably damaging 1.00
R6057:Vmn2r87 UTSW 10 130472357 missense probably benign 0.02
R6220:Vmn2r87 UTSW 10 130479938 missense probably benign 0.01
R6287:Vmn2r87 UTSW 10 130478422 critical splice donor site probably null
R6383:Vmn2r87 UTSW 10 130479000 missense probably damaging 1.00
R6576:Vmn2r87 UTSW 10 130478785 missense probably benign 0.05
R6742:Vmn2r87 UTSW 10 130472527 missense probably damaging 1.00
R7086:Vmn2r87 UTSW 10 130497309 missense probably benign 0.00
R7162:Vmn2r87 UTSW 10 130477547 missense probably benign 0.08
R7419:Vmn2r87 UTSW 10 130472123 missense probably damaging 1.00
R7425:Vmn2r87 UTSW 10 130478892 missense probably damaging 1.00
R7443:Vmn2r87 UTSW 10 130472719 missense probably damaging 1.00
R7571:Vmn2r87 UTSW 10 130479071 missense probably damaging 0.99
R7663:Vmn2r87 UTSW 10 130472185 missense probably damaging 0.97
R7716:Vmn2r87 UTSW 10 130472149 missense probably benign 0.09
R7793:Vmn2r87 UTSW 10 130477544 missense probably benign 0.05
R7806:Vmn2r87 UTSW 10 130479810 missense probably benign
R7841:Vmn2r87 UTSW 10 130497226 missense probably benign 0.31
R8326:Vmn2r87 UTSW 10 130472311 missense possibly damaging 0.67
R8411:Vmn2r87 UTSW 10 130472257 missense probably damaging 0.99
R8445:Vmn2r87 UTSW 10 130477466 missense probably damaging 1.00
R8540:Vmn2r87 UTSW 10 130478893 missense possibly damaging 0.74
R8892:Vmn2r87 UTSW 10 130472236 missense probably damaging 0.99
R9093:Vmn2r87 UTSW 10 130472296 missense probably benign 0.08
Z1088:Vmn2r87 UTSW 10 130472314 missense probably damaging 0.98
Z1176:Vmn2r87 UTSW 10 130471844 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTCTATGACACATGTATCATCTGC -3'
(R):5'- TAGTGCCCAATGCCTATGAATTC -3'

Sequencing Primer
(F):5'- TGACACATGTATCATCTGCTTTAC -3'
(R):5'- CCCAATGCCTATGAATTCTTAAATTG -3'
Posted On 2015-04-06