Mutagenetix > Incidental Mutation

Incidental Mutation 'R3874:Usp34'

276739

Institutional Source

Beutler Lab

Gene Symbol

Usp34

Ensembl Gene

ENSMUSG00000056342

Gene Name

ubiquitin specific peptidase 34

Synonyms

Murr2, A530081C03Rik

MMRRC Submission

040792-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.782) question?

Stock #

R3874 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23306895-23490560 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 23489033 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 3532 (P3532S)

Ref Sequence

ENSEMBL: ENSMUSP00000137430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020529] [ENSMUST00000109539] [ENSMUST00000128559] [ENSMUST00000129368] [ENSMUST00000147157] [ENSMUST00000180046]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000020529

SMART Domains

Protein: ENSMUSP00000020529
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	29	163	2.52e-57	SMART
Pfam:AHSA1	209	325	1.4e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109539

SMART Domains

Protein: ENSMUSP00000105166
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	2	115	2.33e-38	SMART
Pfam:AHSA1	161	277	4.3e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122864

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124801

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125701

Predicted Effect

probably benign
Transcript: ENSMUST00000128372

SMART Domains

Protein: ENSMUSP00000121255
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	15	149	2.52e-57	SMART
Pfam:AHSA1	195	311	7.5e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128559

SMART Domains

Protein: ENSMUSP00000115134
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	29	159	1.59e-54	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129368

SMART Domains

Protein: ENSMUSP00000121426
Gene: ENSMUSG00000056342

Domain	Start	End	E-Value	Type
Blast:Drf_GBD	2	86	1e-19	BLAST
low complexity region	231	244	N/A	INTRINSIC
coiled coil region	259	281	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000137823
AA Change: P3551S

SMART Domains

Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: P3551S

Domain	Start	End	E-Value	Type
low complexity region	489	500	N/A	INTRINSIC
low complexity region	530	544	N/A	INTRINSIC
low complexity region	591	610	N/A	INTRINSIC
coiled coil region	626	671	N/A	INTRINSIC
low complexity region	827	842	N/A	INTRINSIC
low complexity region	1207	1218	N/A	INTRINSIC
low complexity region	1399	1410	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1751	1764	N/A	INTRINSIC
low complexity region	1812	1824	N/A	INTRINSIC
Pfam:UCH	1950	2293	7.6e-44	PFAM
Pfam:UCH_1	1951	2249	3.6e-22	PFAM
low complexity region	2542	2564	N/A	INTRINSIC
low complexity region	2672	2679	N/A	INTRINSIC
Blast:Drf_GBD	2943	3116	3e-53	BLAST
low complexity region	3344	3357	N/A	INTRINSIC
coiled coil region	3371	3393	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147157

SMART Domains

Protein: ENSMUSP00000121920
Gene: ENSMUSG00000020288

Domain	Start	End	E-Value	Type
Aha1_N	29	138	4.15e-26	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000180046
AA Change: P3532S

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: P3532S

Domain	Start	End	E-Value	Type
low complexity region	469	480	N/A	INTRINSIC
low complexity region	510	524	N/A	INTRINSIC
low complexity region	571	590	N/A	INTRINSIC
coiled coil region	607	652	N/A	INTRINSIC
low complexity region	807	822	N/A	INTRINSIC
low complexity region	1187	1198	N/A	INTRINSIC
low complexity region	1379	1390	N/A	INTRINSIC
low complexity region	1498	1512	N/A	INTRINSIC
low complexity region	1731	1744	N/A	INTRINSIC
low complexity region	1792	1804	N/A	INTRINSIC
Pfam:UCH	1930	2273	2.3e-44	PFAM
Pfam:UCH_1	1931	2229	1.1e-22	PFAM
low complexity region	2522	2544	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC
Blast:Drf_GBD	2923	3096	2e-53	BLAST
low complexity region	3324	3337	N/A	INTRINSIC
coiled coil region	3352	3374	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153409

Meta Mutation Damage Score

0.0845

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130213A22Rik	C	A	11: 69,121,475	G26*	probably null	Het
Abca5	T	A	11: 110,310,233	Y447F	probably damaging	Het
Acox2	A	G	14: 8,248,061	I407T	probably benign	Het
Adam8	T	C	7: 139,987,607	N408D	probably damaging	Het
Adgre1	A	T	17: 57,401,925	T39S	probably benign	Het
Akap12	G	A	10: 4,357,590	V1467I	probably benign	Het
Arid1b	T	A	17: 5,336,515		probably null	Het
Atp2c2	A	G	8: 119,735,296	I303V	possibly damaging	Het
Bpifc	C	T	10: 85,991,254	V144I	probably benign	Het
C530008M17Rik	A	G	5: 76,840,892	D30G	probably damaging	Het
Camk4	A	G	18: 33,158,854	E189G	possibly damaging	Het
Casz1	A	G	4: 148,939,589		probably benign	Het
Ccdc134	T	C	15: 82,131,442	V41A	possibly damaging	Het
Chrd	A	T	16: 20,738,910	T753S	probably damaging	Het
Cyb561a3	T	C	19: 10,585,371	V125A	probably benign	Het
D630039A03Rik	T	A	4: 57,910,606	T69S	probably benign	Het
Dchs1	A	G	7: 105,761,635	F1687S	probably damaging	Het
Dlgap4	T	C	2: 156,749,347	S818P	probably benign	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Dnaic2	G	T	11: 114,732,955	G15W	probably damaging	Het
Dsg1c	A	G	18: 20,277,052	I526V	probably benign	Het
Far2	G	A	6: 148,150,591	E123K	probably benign	Het
Gli1	A	T	10: 127,330,219	V1055E	probably damaging	Het
Hand2	G	T	8: 57,321,976	A24S	probably benign	Het
Helb	T	C	10: 120,106,037	I249V	probably benign	Het
Hspa4l	G	A	3: 40,772,642	V492M	probably damaging	Het
Hspg2	T	C	4: 137,539,349	I1916T	probably damaging	Het
Igfals	G	A	17: 24,881,605	V557I	possibly damaging	Het
Itpa	T	G	2: 130,681,010	S176A	probably damaging	Het
Kcnu1	T	A	8: 25,885,317	L353H	probably damaging	Het
Klhl1	A	G	14: 96,518,179	F47L	probably benign	Het
Klhl13	T	C	X: 23,285,176	D21G	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Krt9	C	T	11: 100,190,849	V285I	probably damaging	Het
Mansc1	T	C	6: 134,610,183	R344G	possibly damaging	Het
Mier2	G	T	10: 79,541,797	P439T	possibly damaging	Het
Mppe1	T	A	18: 67,225,886		probably null	Het
Nedd4l	G	A	18: 65,167,535	A243T	probably benign	Het
Notch4	T	A	17: 34,578,069	C934*	probably null	Het
Nsmce3	C	T	7: 64,872,168	D251N	probably damaging	Het
Olfr101	T	A	17: 37,299,979	T148S	probably benign	Het
Olfr1156	T	A	2: 87,949,530	R234S	probably damaging	Het
Olfr1310	T	C	2: 112,008,323	T288A	possibly damaging	Het
Olfr139	A	G	11: 74,044,699	C192R	probably damaging	Het
Olfr517	C	T	7: 108,869,128	V9M	probably damaging	Het
Olfr937	A	G	9: 39,060,174	I164T	probably benign	Het
Pdzd7	T	C	19: 45,045,628	T6A	probably benign	Het
Picalm	T	A	7: 90,189,219	F493Y	probably damaging	Het
Prl7d1	A	G	13: 27,716,668	M1T	probably null	Het
Prl8a1	T	C	13: 27,575,458	K199E	possibly damaging	Het
Rims1	C	T	1: 22,428,489	R764H	probably damaging	Het
Rnf17	G	T	14: 56,475,413	R779L	possibly damaging	Het
Rufy2	T	C	10: 62,998,137	L294P	probably damaging	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Slc22a30	G	T	19: 8,336,849	T491K	probably benign	Het
Slc35b3	T	C	13: 38,943,068	N20D	possibly damaging	Het
Slc5a4a	T	C	10: 76,181,655	F429L	probably benign	Het
Sulf1	T	C	1: 12,817,412	I270T	probably damaging	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tnc	T	A	4: 64,008,710	I860F	probably damaging	Het
Trh	A	T	6: 92,243,698	V61E	possibly damaging	Het
Ttn	T	G	2: 76,754,099	T22222P	probably damaging	Het
Uroc1	A	T	6: 90,361,512	K652*	probably null	Het
Vmn2r120	A	T	17: 57,524,954	F278L	probably benign	Het
Vmn2r7	A	G	3: 64,719,611	F86L	possibly damaging	Het
Vmn2r87	A	T	10: 130,479,987	I70K	possibly damaging	Het
Vps13a	C	T	19: 16,744,953	A332T	probably benign	Het
Zfp568	T	A	7: 30,023,396	C589S	probably damaging	Het

Other mutations in Usp34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL00477:Usp34	APN	11	23468879	missense	probably damaging	0.99
IGL01307:Usp34	APN	11	23417676	missense	probably damaging	0.99
IGL01313:Usp34	APN	11	23473206	missense	probably damaging	1.00
IGL01794:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01826:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01827:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01830:Usp34	APN	11	23436020	missense	probably damaging	0.98
IGL01867:Usp34	APN	11	23384411	missense	possibly damaging	0.77
IGL01939:Usp34	APN	11	23345141	splice site	probably benign
IGL01977:Usp34	APN	11	23452661	missense	probably damaging	1.00
IGL01985:Usp34	APN	11	23452565	missense	probably damaging	1.00
IGL02011:Usp34	APN	11	23471554	missense	probably damaging	0.99
IGL02302:Usp34	APN	11	23467243	missense	possibly damaging	0.91
IGL02423:Usp34	APN	11	23354900	missense	probably benign	0.11
IGL02491:Usp34	APN	11	23432630	missense	probably damaging	0.98
IGL02532:Usp34	APN	11	23370291	missense	probably damaging	0.99
IGL02561:Usp34	APN	11	23351652	missense	probably benign	0.09
IGL02706:Usp34	APN	11	23388659	splice site	probably benign
IGL02891:Usp34	APN	11	23487166	missense	probably benign	0.09
IGL03079:Usp34	APN	11	23432247	missense	possibly damaging	0.48
IGL03089:Usp34	APN	11	23446958	missense	possibly damaging	0.84
IGL03175:Usp34	APN	11	23488686	missense	probably benign
IGL03256:Usp34	APN	11	23420090	nonsense	probably null
IGL03280:Usp34	APN	11	23354897	missense	probably damaging	1.00
IGL03289:Usp34	APN	11	23393818	missense	possibly damaging	0.94
IGL03408:Usp34	APN	11	23446957	missense	possibly damaging	0.92
Chub	UTSW	11	23464686	missense	probably damaging	0.99
Cicione	UTSW	11	23489033	missense	possibly damaging	0.85
R5571_Usp34_680	UTSW	11	23457975	missense	probably damaging	0.99
R5713_Usp34_003	UTSW	11	23343515	missense	possibly damaging	0.94
Roebuck	UTSW	11	23486810	splice site	probably benign
stoat	UTSW	11	23487203	missense
tunnelvision	UTSW	11	23446968	missense
I2288:Usp34	UTSW	11	23432473	splice site	probably benign
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0047:Usp34	UTSW	11	23464403	missense	probably benign	0.34
R0099:Usp34	UTSW	11	23363111	missense	probably damaging	1.00
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0240:Usp34	UTSW	11	23433206	missense	probably damaging	0.99
R0403:Usp34	UTSW	11	23333838	missense	possibly damaging	0.82
R0432:Usp34	UTSW	11	23401505	missense	probably damaging	0.99
R0446:Usp34	UTSW	11	23467207	missense	probably damaging	0.97
R0455:Usp34	UTSW	11	23446741	splice site	probably benign
R0470:Usp34	UTSW	11	23436001	missense	possibly damaging	0.94
R0472:Usp34	UTSW	11	23384509	splice site	probably benign
R0512:Usp34	UTSW	11	23451997	missense	probably benign	0.04
R0557:Usp34	UTSW	11	23403848	missense	probably damaging	0.98
R0562:Usp34	UTSW	11	23432406	splice site	probably benign
R0656:Usp34	UTSW	11	23472967	missense	probably damaging	0.99
R0693:Usp34	UTSW	11	23452637	missense	probably damaging	0.97
R0739:Usp34	UTSW	11	23467243	missense	possibly damaging	0.91
R1061:Usp34	UTSW	11	23384420	missense	possibly damaging	0.51
R1078:Usp34	UTSW	11	23433175	splice site	probably benign
R1223:Usp34	UTSW	11	23446464	splice site	probably null
R1295:Usp34	UTSW	11	23384477	missense	probably damaging	1.00
R1430:Usp34	UTSW	11	23459151	missense	probably damaging	0.97
R1445:Usp34	UTSW	11	23351629	missense	probably damaging	0.99
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1468:Usp34	UTSW	11	23441171	missense	probably damaging	1.00
R1471:Usp34	UTSW	11	23488862	missense	probably benign	0.20
R1475:Usp34	UTSW	11	23473253	missense	probably damaging	0.99
R1628:Usp34	UTSW	11	23488725	missense	probably damaging	1.00
R1631:Usp34	UTSW	11	23460651	missense	probably damaging	0.99
R1655:Usp34	UTSW	11	23375051	missense	probably benign	0.05
R1741:Usp34	UTSW	11	23364103	missense	probably benign	0.00
R1854:Usp34	UTSW	11	23426153	missense	probably benign	0.24
R1867:Usp34	UTSW	11	23361593	missense	possibly damaging	0.82
R1869:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1870:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1871:Usp34	UTSW	11	23364479	missense	probably benign	0.37
R1967:Usp34	UTSW	11	23364503	missense	probably benign	0.01
R2051:Usp34	UTSW	11	23464468	missense	probably damaging	0.97
R2132:Usp34	UTSW	11	23464556	missense	possibly damaging	0.95
R2156:Usp34	UTSW	11	23382602	missense	probably damaging	0.98
R2205:Usp34	UTSW	11	23385147	missense	probably damaging	0.97
R2342:Usp34	UTSW	11	23403599	missense	possibly damaging	0.46
R3431:Usp34	UTSW	11	23370466	missense	possibly damaging	0.95
R3812:Usp34	UTSW	11	23464517	missense	possibly damaging	0.94
R3872:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3873:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3875:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R3925:Usp34	UTSW	11	23343640	missense	probably benign	0.28
R3972:Usp34	UTSW	11	23457803	missense	probably damaging	1.00
R4018:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4042:Usp34	UTSW	11	23489033	missense	possibly damaging	0.85
R4155:Usp34	UTSW	11	23417676	missense	probably damaging	0.99
R4197:Usp34	UTSW	11	23444189	missense	probably damaging	0.98
R4352:Usp34	UTSW	11	23320727	missense	possibly damaging	0.73
R4379:Usp34	UTSW	11	23384499	missense	possibly damaging	0.52
R4444:Usp34	UTSW	11	23435998	missense	probably damaging	0.98
R4475:Usp34	UTSW	11	23457975	missense	possibly damaging	0.95
R4501:Usp34	UTSW	11	23401529	missense	probably damaging	1.00
R4527:Usp34	UTSW	11	23421257	missense	possibly damaging	0.57
R4603:Usp34	UTSW	11	23464633	missense	probably damaging	0.97
R4612:Usp34	UTSW	11	23432268	missense	probably damaging	0.99
R4673:Usp34	UTSW	11	23364480	small deletion	probably benign
R4707:Usp34	UTSW	11	23487215	missense	probably damaging	1.00
R4736:Usp34	UTSW	11	23393749	splice site	probably null
R4867:Usp34	UTSW	11	23451999	missense	probably benign	0.28
R4879:Usp34	UTSW	11	23373410	missense	possibly damaging	0.94
R4977:Usp34	UTSW	11	23488982	missense	probably damaging	1.00
R5004:Usp34	UTSW	11	23464586	missense	probably damaging	1.00
R5057:Usp34	UTSW	11	23458086	intron	probably benign
R5068:Usp34	UTSW	11	23460665	missense	possibly damaging	0.94
R5304:Usp34	UTSW	11	23343616	missense	probably damaging	1.00
R5320:Usp34	UTSW	11	23333739	missense	probably benign
R5327:Usp34	UTSW	11	23468846	missense	probably damaging	1.00
R5328:Usp34	UTSW	11	23464616	missense	probably benign	0.01
R5328:Usp34	UTSW	11	23488659	missense	probably benign	0.04
R5390:Usp34	UTSW	11	23444202	critical splice donor site	probably null
R5434:Usp34	UTSW	11	23412271	missense	probably damaging	0.99
R5523:Usp34	UTSW	11	23349198	missense	probably benign	0.39
R5567:Usp34	UTSW	11	23488336	missense	probably damaging	0.97
R5571:Usp34	UTSW	11	23457975	missense	probably damaging	0.99
R5645:Usp34	UTSW	11	23375024	missense	possibly damaging	0.86
R5713:Usp34	UTSW	11	23343515	missense	possibly damaging	0.94
R5719:Usp34	UTSW	11	23354846	missense	probably benign	0.00
R5813:Usp34	UTSW	11	23421340	missense	probably benign	0.38
R5921:Usp34	UTSW	11	23464686	missense	probably damaging	0.99
R5928:Usp34	UTSW	11	23436040	missense	probably damaging	0.98
R5944:Usp34	UTSW	11	23363089	missense	probably damaging	1.00
R6198:Usp34	UTSW	11	23484127	missense	probably damaging	1.00
R6229:Usp34	UTSW	11	23446778	missense	probably damaging	0.99
R6306:Usp34	UTSW	11	23412260	missense	possibly damaging	0.94
R6320:Usp34	UTSW	11	23452520	missense	probably damaging	0.98
R6341:Usp34	UTSW	11	23381353	missense	probably damaging	0.97
R6374:Usp34	UTSW	11	23438914	missense	probably damaging	1.00
R6398:Usp34	UTSW	11	23488666	missense	probably benign
R6438:Usp34	UTSW	11	23364266	missense	probably benign	0.02
R6668:Usp34	UTSW	11	23460659	missense	probably damaging	0.97
R6700:Usp34	UTSW	11	23439011	missense	probably damaging	1.00
R6783:Usp34	UTSW	11	23412318	missense	probably damaging	1.00
R6821:Usp34	UTSW	11	23367491	missense	possibly damaging	0.79
R6855:Usp34	UTSW	11	23452569	missense	possibly damaging	0.94
R6916:Usp34	UTSW	11	23458023	missense	probably damaging	0.98
R7020:Usp34	UTSW	11	23393954	missense	probably benign	0.05
R7026:Usp34	UTSW	11	23361622	missense	probably damaging	1.00
R7085:Usp34	UTSW	11	23363097	missense
R7101:Usp34	UTSW	11	23426183	missense
R7168:Usp34	UTSW	11	23464585	missense
R7192:Usp34	UTSW	11	23460571	missense
R7264:Usp34	UTSW	11	23333566	missense	probably benign	0.00
R7325:Usp34	UTSW	11	23419052	missense
R7343:Usp34	UTSW	11	23488868	missense
R7358:Usp34	UTSW	11	23361683	missense	probably damaging	0.99
R7369:Usp34	UTSW	11	23432361	missense
R7389:Usp34	UTSW	11	23345200	missense
R7459:Usp34	UTSW	11	23364458	missense	possibly damaging	0.53
R7517:Usp34	UTSW	11	23446968	missense
R7729:Usp34	UTSW	11	23449268	missense
R7777:Usp34	UTSW	11	23382638	missense
R7810:Usp34	UTSW	11	23412314	missense
R7836:Usp34	UTSW	11	23446614	missense
R7862:Usp34	UTSW	11	23464718	missense
R7993:Usp34	UTSW	11	23377622	missense
R8050:Usp34	UTSW	11	23446787	missense
R8054:Usp34	UTSW	11	23361295	missense
R8239:Usp34	UTSW	11	23446750	missense
R8266:Usp34	UTSW	11	23486810	splice site	probably benign
R8347:Usp34	UTSW	11	23412345	missense
R8409:Usp34	UTSW	11	23457811	missense
R8692:Usp34	UTSW	11	23429325	missense
R8694:Usp34	UTSW	11	23484161	missense
R8734:Usp34	UTSW	11	23444184	missense
R8806:Usp34	UTSW	11	23484143	missense
R8914:Usp34	UTSW	11	23343604	missense
R8987:Usp34	UTSW	11	23464267	missense
R9013:Usp34	UTSW	11	23370302	missense
R9108:Usp34	UTSW	11	23370528	missense
R9264:Usp34	UTSW	11	23489064	missense
R9301:Usp34	UTSW	11	23472951	missense
R9375:Usp34	UTSW	11	23487203	missense
R9385:Usp34	UTSW	11	23449223	missense
R9500:Usp34	UTSW	11	23381337	missense	probably damaging	0.99
R9566:Usp34	UTSW	11	23367529	missense
R9629:Usp34	UTSW	11	23364364	missense
R9679:Usp34	UTSW	11	23444369	missense
R9680:Usp34	UTSW	11	23367385	missense	possibly damaging	0.94
R9686:Usp34	UTSW	11	23474351	missense
R9752:Usp34	UTSW	11	23459182	missense	probably benign	0.11
X0023:Usp34	UTSW	11	23375028	missense	possibly damaging	0.73
X0057:Usp34	UTSW	11	23457824	missense	possibly damaging	0.86
Z1176:Usp34	UTSW	11	23473221	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGAAGATGGTTCACATATCCGG -3'
(R):5'- GCACGTGAGAATAGACATGCC -3'

Sequencing Primer
(F):5'- GATGGTTCACATATCCGGTCACAG -3'
(R):5'- CACGTCTAATGTCAAGAAGCAGCTTG -3'

Posted On

2015-04-06