Mutagenetix > Incidental Mutation

Incidental Mutation 'R3874:Abca5'

276744

Institutional Source

Beutler Lab

Gene Symbol

Abca5

Ensembl Gene

ENSMUSG00000018800

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 5

Synonyms

ABC13, B930033A02Rik

MMRRC Submission

040792-MU

Accession Numbers

NCBI RefSeq: NM_147219.2; MGI: 2386607

Essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R3874 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110269369-110337716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110310233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 447 (Y447F)

Ref Sequence

ENSEMBL: ENSMUSP00000120708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043961] [ENSMUST00000124714]

AlphaFold

Q8K448

Predicted Effect

probably damaging
Transcript: ENSMUST00000043961
AA Change: Y447F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047927
Gene: ENSMUSG00000018800
AA Change: Y447F

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	29	416	4.3e-33	PFAM
AAA	506	691	2.88e-8	SMART
low complexity region	733	744	N/A	INTRINSIC
transmembrane domain	864	886	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC
low complexity region	1262	1267	N/A	INTRINSIC
AAA	1325	1512	3.52e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000124714
AA Change: Y447F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120708
Gene: ENSMUSG00000018800
AA Change: Y447F

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	30	416	9.5e-32	PFAM
AAA	506	691	2.88e-8	SMART
low complexity region	733	744	N/A	INTRINSIC
transmembrane domain	864	886	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC
transmembrane domain	1019	1041	N/A	INTRINSIC
transmembrane domain	1074	1096	N/A	INTRINSIC
transmembrane domain	1103	1125	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
transmembrane domain	1165	1187	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127318

Meta Mutation Damage Score

0.1480

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

Strain: 3581814
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exophthalmos, tremors and collapse of the thyroid gland, and develop a dilated cardiomyopathy with large thrombi due to depression of the cardiac function. Severe edema, liver injury and premature death appear to be sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130213A22Rik	C	A	11: 69,121,475	G26*	probably null	Het
Acox2	A	G	14: 8,248,061	I407T	probably benign	Het
Adam8	T	C	7: 139,987,607	N408D	probably damaging	Het
Adgre1	A	T	17: 57,401,925	T39S	probably benign	Het
Akap12	G	A	10: 4,357,590	V1467I	probably benign	Het
Arid1b	T	A	17: 5,336,515		probably null	Het
Atp2c2	A	G	8: 119,735,296	I303V	possibly damaging	Het
Bpifc	C	T	10: 85,991,254	V144I	probably benign	Het
C530008M17Rik	A	G	5: 76,840,892	D30G	probably damaging	Het
Camk4	A	G	18: 33,158,854	E189G	possibly damaging	Het
Casz1	A	G	4: 148,939,589		probably benign	Het
Ccdc134	T	C	15: 82,131,442	V41A	possibly damaging	Het
Chrd	A	T	16: 20,738,910	T753S	probably damaging	Het
Cyb561a3	T	C	19: 10,585,371	V125A	probably benign	Het
D630039A03Rik	T	A	4: 57,910,606	T69S	probably benign	Het
Dchs1	A	G	7: 105,761,635	F1687S	probably damaging	Het
Dlgap4	T	C	2: 156,749,347	S818P	probably benign	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Dnaic2	G	T	11: 114,732,955	G15W	probably damaging	Het
Dsg1c	A	G	18: 20,277,052	I526V	probably benign	Het
Far2	G	A	6: 148,150,591	E123K	probably benign	Het
Gli1	A	T	10: 127,330,219	V1055E	probably damaging	Het
Hand2	G	T	8: 57,321,976	A24S	probably benign	Het
Helb	T	C	10: 120,106,037	I249V	probably benign	Het
Hspa4l	G	A	3: 40,772,642	V492M	probably damaging	Het
Hspg2	T	C	4: 137,539,349	I1916T	probably damaging	Het
Igfals	G	A	17: 24,881,605	V557I	possibly damaging	Het
Itpa	T	G	2: 130,681,010	S176A	probably damaging	Het
Kcnu1	T	A	8: 25,885,317	L353H	probably damaging	Het
Klhl1	A	G	14: 96,518,179	F47L	probably benign	Het
Klhl13	T	C	X: 23,285,176	D21G	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Krt9	C	T	11: 100,190,849	V285I	probably damaging	Het
Mansc1	T	C	6: 134,610,183	R344G	possibly damaging	Het
Mier2	G	T	10: 79,541,797	P439T	possibly damaging	Het
Mppe1	T	A	18: 67,225,886		probably null	Het
Nedd4l	G	A	18: 65,167,535	A243T	probably benign	Het
Notch4	T	A	17: 34,578,069	C934*	probably null	Het
Nsmce3	C	T	7: 64,872,168	D251N	probably damaging	Het
Olfr101	T	A	17: 37,299,979	T148S	probably benign	Het
Olfr1156	T	A	2: 87,949,530	R234S	probably damaging	Het
Olfr1310	T	C	2: 112,008,323	T288A	possibly damaging	Het
Olfr139	A	G	11: 74,044,699	C192R	probably damaging	Het
Olfr517	C	T	7: 108,869,128	V9M	probably damaging	Het
Olfr937	A	G	9: 39,060,174	I164T	probably benign	Het
Pdzd7	T	C	19: 45,045,628	T6A	probably benign	Het
Picalm	T	A	7: 90,189,219	F493Y	probably damaging	Het
Prl7d1	A	G	13: 27,716,668	M1T	probably null	Het
Prl8a1	T	C	13: 27,575,458	K199E	possibly damaging	Het
Rims1	C	T	1: 22,428,489	R764H	probably damaging	Het
Rnf17	G	T	14: 56,475,413	R779L	possibly damaging	Het
Rufy2	T	C	10: 62,998,137	L294P	probably damaging	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Slc22a30	G	T	19: 8,336,849	T491K	probably benign	Het
Slc35b3	T	C	13: 38,943,068	N20D	possibly damaging	Het
Slc5a4a	T	C	10: 76,181,655	F429L	probably benign	Het
Sulf1	T	C	1: 12,817,412	I270T	probably damaging	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tnc	T	A	4: 64,008,710	I860F	probably damaging	Het
Trh	A	T	6: 92,243,698	V61E	possibly damaging	Het
Ttn	T	G	2: 76,754,099	T22222P	probably damaging	Het
Uroc1	A	T	6: 90,361,512	K652*	probably null	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r120	A	T	17: 57,524,954	F278L	probably benign	Het
Vmn2r7	A	G	3: 64,719,611	F86L	possibly damaging	Het
Vmn2r87	A	T	10: 130,479,987	I70K	possibly damaging	Het
Vps13a	C	T	19: 16,744,953	A332T	probably benign	Het
Zfp568	T	A	7: 30,023,396	C589S	probably damaging	Het

Other mutations in Abca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Abca5	APN	11	110309450	critical splice acceptor site	probably null
IGL00675:Abca5	APN	11	110304985	missense	probably damaging	1.00
IGL01512:Abca5	APN	11	110317823	missense	probably benign	0.40
IGL01559:Abca5	APN	11	110272526	missense	probably benign
IGL01584:Abca5	APN	11	110304923	missense	probably damaging	0.98
IGL01604:Abca5	APN	11	110277636	missense	possibly damaging	0.47
IGL01828:Abca5	APN	11	110287695	missense	probably benign
IGL01880:Abca5	APN	11	110293263	missense	probably benign	0.01
IGL02054:Abca5	APN	11	110292123	missense	probably damaging	0.99
IGL02074:Abca5	APN	11	110293350	missense	probably benign	0.00
IGL02233:Abca5	APN	11	110274344	nonsense	probably null
IGL02245:Abca5	APN	11	110298169	nonsense	probably null
IGL02317:Abca5	APN	11	110327761	missense	probably benign	0.09
IGL02352:Abca5	APN	11	110275330	missense	probably benign	0.01
IGL02359:Abca5	APN	11	110275330	missense	probably benign	0.01
IGL02390:Abca5	APN	11	110296551	missense	probably benign
IGL02600:Abca5	APN	11	110309438	missense	probably benign	0.02
IGL02639:Abca5	APN	11	110288073	missense	possibly damaging	0.79
IGL03000:Abca5	APN	11	110317814	missense	probably benign	0.04
IGL03074:Abca5	APN	11	110310275	missense	probably benign	0.01
IGL03078:Abca5	APN	11	110276545	nonsense	probably null
IGL03342:Abca5	APN	11	110287691	missense	possibly damaging	0.94
IGL03368:Abca5	APN	11	110313522	splice site	probably benign
atles	UTSW	11	110299929	missense	probably damaging	0.99
Demento	UTSW	11	110310233	missense	probably damaging	1.00
jones	UTSW	11	110288058	splice site	probably null
smith	UTSW	11	110301545	missense	probably benign	0.22
R0106:Abca5	UTSW	11	110319825	missense	probably damaging	1.00
R0116:Abca5	UTSW	11	110276505	missense	probably damaging	1.00
R0305:Abca5	UTSW	11	110273311	splice site	probably benign
R0550:Abca5	UTSW	11	110293840	missense	probably damaging	1.00
R0578:Abca5	UTSW	11	110276489	nonsense	probably null
R0587:Abca5	UTSW	11	110311377	missense	probably benign	0.00
R0610:Abca5	UTSW	11	110301527	missense	probably benign	0.00
R0617:Abca5	UTSW	11	110279689	missense	probably damaging	0.98
R0667:Abca5	UTSW	11	110327811	missense	probably benign	0.00
R0844:Abca5	UTSW	11	110319832	missense	probably benign	0.00
R1273:Abca5	UTSW	11	110326665	missense	probably benign	0.01
R1463:Abca5	UTSW	11	110314558	missense	probably damaging	1.00
R1511:Abca5	UTSW	11	110299978	missense	probably damaging	1.00
R1511:Abca5	UTSW	11	110299986	missense	possibly damaging	0.73
R1687:Abca5	UTSW	11	110293888	missense	probably benign	0.32
R1759:Abca5	UTSW	11	110293848	missense	probably benign
R1870:Abca5	UTSW	11	110329217	missense	probably benign	0.33
R2006:Abca5	UTSW	11	110313449	missense	probably benign
R2039:Abca5	UTSW	11	110299929	missense	probably damaging	0.99
R2076:Abca5	UTSW	11	110287652	missense	probably benign	0.10
R2136:Abca5	UTSW	11	110319832	missense	probably benign	0.00
R2154:Abca5	UTSW	11	110292174	missense	probably benign	0.00
R2273:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2274:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2275:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2328:Abca5	UTSW	11	110276521	missense	probably damaging	0.99
R3702:Abca5	UTSW	11	110288058	splice site	probably null
R3768:Abca5	UTSW	11	110313391	missense	probably benign	0.01
R3872:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3873:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3875:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R4347:Abca5	UTSW	11	110299968	missense	probably damaging	1.00
R4429:Abca5	UTSW	11	110311410	missense	probably benign	0.00
R4790:Abca5	UTSW	11	110311410	missense	possibly damaging	0.63
R4812:Abca5	UTSW	11	110301821	missense	probably damaging	1.00
R4833:Abca5	UTSW	11	110279316	missense	probably benign	0.00
R4883:Abca5	UTSW	11	110326631	missense	probably damaging	1.00
R5000:Abca5	UTSW	11	110310224	missense	probably damaging	1.00
R5004:Abca5	UTSW	11	110279376	missense	probably damaging	0.99
R5066:Abca5	UTSW	11	110309350	intron	probably benign
R5230:Abca5	UTSW	11	110319860	missense	probably benign
R5321:Abca5	UTSW	11	110327825	missense	probably benign
R5350:Abca5	UTSW	11	110319796	nonsense	probably null
R5414:Abca5	UTSW	11	110314622	missense	probably damaging	1.00
R5437:Abca5	UTSW	11	110319796	nonsense	probably null
R5451:Abca5	UTSW	11	110319796	nonsense	probably null
R5453:Abca5	UTSW	11	110319796	nonsense	probably null
R5488:Abca5	UTSW	11	110292183	missense	probably benign	0.00
R5636:Abca5	UTSW	11	110301536	missense	probably benign	0.00
R5805:Abca5	UTSW	11	110279390	missense	probably benign	0.06
R5900:Abca5	UTSW	11	110279156	missense	possibly damaging	0.92
R6152:Abca5	UTSW	11	110313361	missense	probably damaging	1.00
R6167:Abca5	UTSW	11	110292105	missense	probably benign	0.10
R6343:Abca5	UTSW	11	110314552	missense	probably damaging	1.00
R6425:Abca5	UTSW	11	110329232	missense	possibly damaging	0.75
R6493:Abca5	UTSW	11	110293878	missense	probably benign	0.00
R6498:Abca5	UTSW	11	110292102	missense	possibly damaging	0.70
R6884:Abca5	UTSW	11	110329217	missense	probably damaging	0.96
R6912:Abca5	UTSW	11	110306280	missense	probably benign	0.35
R7084:Abca5	UTSW	11	110301545	missense	probably benign	0.22
R7239:Abca5	UTSW	11	110326704	missense	possibly damaging	0.94
R7490:Abca5	UTSW	11	110277611	missense	possibly damaging	0.95
R7527:Abca5	UTSW	11	110327730	critical splice donor site	probably null
R7702:Abca5	UTSW	11	110276452	critical splice donor site	probably null
R7763:Abca5	UTSW	11	110272497	missense	possibly damaging	0.85
R8237:Abca5	UTSW	11	110310155	missense	probably benign	0.01
R8910:Abca5	UTSW	11	110298204	missense	probably damaging	0.96
R9028:Abca5	UTSW	11	110298078	missense	probably damaging	1.00
R9124:Abca5	UTSW	11	110298179	missense	possibly damaging	0.91
R9151:Abca5	UTSW	11	110298082	missense	probably benign
R9187:Abca5	UTSW	11	110310135	critical splice donor site	probably null
R9249:Abca5	UTSW	11	110329339	intron	probably benign
R9322:Abca5	UTSW	11	110301505	missense	probably damaging	0.96
R9391:Abca5	UTSW	11	110287716	missense	probably benign
R9435:Abca5	UTSW	11	110292085	critical splice donor site	probably null
R9557:Abca5	UTSW	11	110306283	missense	probably damaging	1.00
R9660:Abca5	UTSW	11	110277422	missense	possibly damaging	0.80
R9788:Abca5	UTSW	11	110301427	missense	probably damaging	1.00
RF014:Abca5	UTSW	11	110279754	critical splice acceptor site	probably null
Z1177:Abca5	UTSW	11	110279328	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ATCCGGTCTCTTCTATGATAGTGTAAC -3'
(R):5'- ATTCCAGGCCTGTGTAATGTG -3'

Sequencing Primer
(F):5'- TCCATCAGCAGTTCTACC -3'
(R):5'- CCAGGCCTGTGTAATGTGATAAC -3'

Posted On

2015-04-06