Incidental Mutation 'R3874:Sgsh'
ID 276746
Institutional Source Beutler Lab
Gene Symbol Sgsh
Ensembl Gene ENSMUSG00000005043
Gene Name N-sulfoglucosamine sulfohydrolase (sulfamidase)
Synonyms sulphamidase, 4632406A19Rik
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R3874 (G1)
Quality Score 181
Status Not validated
Chromosome 11
Chromosomal Location 119343425-119355536 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119350947 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 111 (L111P)
Ref Sequence ENSEMBL: ENSMUSP00000097748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005173] [ENSMUST00000050880] [ENSMUST00000100172] [ENSMUST00000136523]
AlphaFold Q9EQ08
Predicted Effect probably damaging
Transcript: ENSMUST00000005173
AA Change: L111P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005173
Gene: ENSMUSG00000005043
AA Change: L111P

DomainStartEndE-ValueType
Pfam:Sulfatase 23 328 2.6e-60 PFAM
Pfam:Phosphodiest 25 287 5.2e-8 PFAM
low complexity region 348 357 N/A INTRINSIC
Pfam:DUF4976 400 477 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050880
SMART Domains Protein: ENSMUSP00000050999
Gene: ENSMUSG00000039908

DomainStartEndE-ValueType
Pfam:Sulfate_transp 31 424 1.8e-97 PFAM
transmembrane domain 426 448 N/A INTRINSIC
Pfam:STAS 453 559 3.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100172
AA Change: L111P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097748
Gene: ENSMUSG00000005043
AA Change: L111P

DomainStartEndE-ValueType
Pfam:Sulfatase 23 250 1.7e-35 PFAM
Pfam:Phosphodiest 25 237 2.7e-8 PFAM
low complexity region 311 329 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133507
Predicted Effect probably damaging
Transcript: ENSMUST00000136523
AA Change: S84P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115587
Gene: ENSMUSG00000005043
AA Change: S84P

DomainStartEndE-ValueType
PDB:4MIV|H 1 30 1e-5 PDB
low complexity region 40 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147366
Meta Mutation Damage Score 0.9700 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with Sanfilippo syndrome A, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele die prematurely displaying low sulfamidase activity, variable lysosomal storage in various brain cell types and other tissues, heparan sulfate-uria, scruffy coats, corneal opacities, bladder distension, hydronephrosis, hepatosplenomegaly and bone deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Sgsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Sgsh APN 11 119346485 missense probably benign
IGL01549:Sgsh APN 11 119350929 missense probably damaging 0.99
IGL02110:Sgsh APN 11 119352806 missense probably damaging 1.00
IGL02878:Sgsh APN 11 119346558 missense probably damaging 1.00
hindenburg UTSW 11 119350947 missense probably damaging 1.00
ludendorff UTSW 11 119346357 missense probably damaging 1.00
BB005:Sgsh UTSW 11 119347735 missense probably benign 0.03
BB015:Sgsh UTSW 11 119347735 missense probably benign 0.03
R1187:Sgsh UTSW 11 119346578 nonsense probably null
R2342:Sgsh UTSW 11 119347714 missense probably benign 0.01
R2472:Sgsh UTSW 11 119355474 missense possibly damaging 0.83
R2571:Sgsh UTSW 11 119350514 missense probably damaging 1.00
R3872:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3873:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3875:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R5075:Sgsh UTSW 11 119346768 missense probably benign 0.34
R5660:Sgsh UTSW 11 119350981 missense probably damaging 1.00
R5938:Sgsh UTSW 11 119346799 missense probably benign 0.08
R7302:Sgsh UTSW 11 119347699 missense probably benign 0.02
R7484:Sgsh UTSW 11 119346357 missense probably damaging 1.00
R7533:Sgsh UTSW 11 119347870 missense probably damaging 1.00
R7552:Sgsh UTSW 11 119346552 missense probably damaging 1.00
R7928:Sgsh UTSW 11 119347735 missense probably benign 0.03
R7958:Sgsh UTSW 11 119352773 missense probably damaging 0.98
R8013:Sgsh UTSW 11 119352695 missense probably damaging 0.97
R8014:Sgsh UTSW 11 119352695 missense probably damaging 0.97
R8912:Sgsh UTSW 11 119352660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGTGGCCTTGCACCTG -3'
(R):5'- CTTTTACAGAGACAGGGCCTAGG -3'

Sequencing Primer
(F):5'- ACCTGCATCCTGTCCTCAG -3'
(R):5'- AGCTCACTGTGCAGCTG -3'
Posted On 2015-04-06