Incidental Mutation 'R3874:Slc35b3'
ID276748
Institutional Source Beutler Lab
Gene Symbol Slc35b3
Ensembl Gene ENSMUSG00000021432
Gene Namesolute carrier family 35, member B3
Synonyms4921526O06Rik, PAPST2
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R3874 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location38932136-38960875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38943068 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 20 (N20D)
Ref Sequence ENSEMBL: ENSMUSP00000153010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021870] [ENSMUST00000167513] [ENSMUST00000224429] [ENSMUST00000224645] [ENSMUST00000225331] [ENSMUST00000225396] [ENSMUST00000225432] [ENSMUST00000225461] [ENSMUST00000225568] [ENSMUST00000225714]
Predicted Effect probably benign
Transcript: ENSMUST00000021870
AA Change: N237D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021870
Gene: ENSMUSG00000021432
AA Change: N237D

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:UAA 92 383 3.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167513
AA Change: N193D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126016
Gene: ENSMUSG00000021432
AA Change: N193D

DomainStartEndE-ValueType
Pfam:UAA 49 343 4e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223619
Predicted Effect possibly damaging
Transcript: ENSMUST00000224429
AA Change: N20D

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000224645
AA Change: N20D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000225331
Predicted Effect probably benign
Transcript: ENSMUST00000225396
AA Change: N29D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000225432
AA Change: N193D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000225461
Predicted Effect probably benign
Transcript: ENSMUST00000225568
AA Change: N95D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225714
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family. The encoded protein is involved in the transport of 3-prime phosphoadenosine 5-prime phosphosulfate (PAPS) from the nucleus or the cytosol to the Golgi lumen. This gene has been reported to be expressed preferentially in the human colon tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Slc35b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Slc35b3 APN 13 38943140 missense possibly damaging 0.82
IGL02111:Slc35b3 APN 13 38955782 missense probably damaging 0.99
R0883:Slc35b3 UTSW 13 38937275 missense probably benign 0.09
R1170:Slc35b3 UTSW 13 38937331 missense probably benign 0.03
R1440:Slc35b3 UTSW 13 38954134 nonsense probably null
R1653:Slc35b3 UTSW 13 38955798 missense probably benign 0.02
R1900:Slc35b3 UTSW 13 38960611 critical splice donor site probably null
R3897:Slc35b3 UTSW 13 38934763 missense probably benign 0.09
R4399:Slc35b3 UTSW 13 38937815 missense possibly damaging 0.95
R4937:Slc35b3 UTSW 13 38932911 missense possibly damaging 0.89
R4955:Slc35b3 UTSW 13 38932890 missense probably benign 0.08
R5034:Slc35b3 UTSW 13 38943158 missense probably damaging 1.00
R5770:Slc35b3 UTSW 13 38937758 missense probably damaging 0.98
R6155:Slc35b3 UTSW 13 38944596 missense probably damaging 1.00
R6663:Slc35b3 UTSW 13 38954136 missense probably damaging 0.99
R7701:Slc35b3 UTSW 13 38944635 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTACTGATGCACCTGGAG -3'
(R):5'- ATCCATATTCTGCCTGGTGAGG -3'

Sequencing Primer
(F):5'- TGATGCACCTGGAGCCTCTAG -3'
(R):5'- CCTGGTGAGGCACTGTGAG -3'
Posted On2015-04-06