Incidental Mutation 'R3874:Klhl1'
ID 276751
Institutional Source Beutler Lab
Gene Symbol Klhl1
Ensembl Gene ENSMUSG00000022076
Gene Name kelch-like 1
Synonyms
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R3874 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 96102736-96519102 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96518179 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 47 (F47L)
Ref Sequence ENSEMBL: ENSMUSP00000022666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022666]
AlphaFold Q9JI74
Predicted Effect probably benign
Transcript: ENSMUST00000022666
AA Change: F47L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022666
Gene: ENSMUSG00000022076
AA Change: F47L

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
BTB 215 312 1.13e-28 SMART
BACK 317 418 5.03e-34 SMART
Kelch 463 509 8.86e-10 SMART
Kelch 510 556 1.04e-15 SMART
Kelch 557 603 6.76e-15 SMART
Kelch 604 650 2.23e-15 SMART
Kelch 651 703 3.09e-9 SMART
Kelch 704 750 3.43e-16 SMART
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The KLHL1 protein belongs to a family of actin-organizing proteins related to Drosophila Kelch (Nemes et al., 2000 [PubMed 10888605]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice both homozygous and heterozygous for disruption of this gene develop abnormalities in gait and defects in motor coordination with time. Dendritic atrophy of Purkinje cells is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Klhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:Klhl1 APN 14 96201204 splice site probably benign
IGL02055:Klhl1 APN 14 96280103 missense possibly damaging 0.96
IGL02110:Klhl1 APN 14 96136603 missense probably benign 0.27
IGL02216:Klhl1 APN 14 96123222 missense probably benign 0.08
IGL02307:Klhl1 APN 14 96201373 missense possibly damaging 0.68
IGL02538:Klhl1 APN 14 96240213 missense probably benign 0.03
IGL02559:Klhl1 APN 14 96151960 missense possibly damaging 0.95
IGL02682:Klhl1 APN 14 96201342 missense possibly damaging 0.83
IGL03228:Klhl1 APN 14 96240327 missense probably damaging 1.00
LCD18:Klhl1 UTSW 14 96317730 intron probably benign
P0041:Klhl1 UTSW 14 96280211 missense probably damaging 1.00
R0270:Klhl1 UTSW 14 96518344 start gained probably benign
R0419:Klhl1 UTSW 14 96381789 missense probably benign 0.30
R0938:Klhl1 UTSW 14 96152040 nonsense probably null
R1465:Klhl1 UTSW 14 96240213 missense probably benign 0.03
R1465:Klhl1 UTSW 14 96240213 missense probably benign 0.03
R1590:Klhl1 UTSW 14 96368636 missense probably damaging 1.00
R1597:Klhl1 UTSW 14 96201211 critical splice donor site probably null
R1893:Klhl1 UTSW 14 96240206 critical splice donor site probably null
R1928:Klhl1 UTSW 14 96346789 missense probably benign 0.02
R2272:Klhl1 UTSW 14 96517908 missense probably benign 0.00
R3612:Klhl1 UTSW 14 96381770 critical splice donor site probably null
R3852:Klhl1 UTSW 14 96280205 missense probably benign 0.12
R3872:Klhl1 UTSW 14 96518179 missense probably benign 0.03
R3923:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R3925:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R3926:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R4151:Klhl1 UTSW 14 96518316 start codon destroyed probably null 0.73
R4502:Klhl1 UTSW 14 96517846 missense probably benign
R4536:Klhl1 UTSW 14 96136583 critical splice donor site probably null
R4729:Klhl1 UTSW 14 96280148 missense probably damaging 1.00
R4756:Klhl1 UTSW 14 96151966 missense probably benign 0.39
R5001:Klhl1 UTSW 14 96136610 missense probably damaging 0.96
R5022:Klhl1 UTSW 14 96136706 missense probably benign 0.31
R5616:Klhl1 UTSW 14 96518293 missense probably benign 0.44
R5634:Klhl1 UTSW 14 96240271 missense probably damaging 0.96
R5700:Klhl1 UTSW 14 96518040 missense probably benign
R5701:Klhl1 UTSW 14 96201380 missense probably benign
R5934:Klhl1 UTSW 14 96123215 critical splice donor site probably null
R5950:Klhl1 UTSW 14 96240354 missense probably damaging 0.99
R6454:Klhl1 UTSW 14 96280091 missense possibly damaging 0.66
R6496:Klhl1 UTSW 14 96240216 missense probably benign 0.03
R6606:Klhl1 UTSW 14 96123222 missense possibly damaging 0.52
R6644:Klhl1 UTSW 14 96517918 missense probably benign
R6745:Klhl1 UTSW 14 96280002 critical splice donor site probably null
R6919:Klhl1 UTSW 14 96136594 missense probably benign 0.00
R7029:Klhl1 UTSW 14 96518196 missense probably benign 0.01
R7195:Klhl1 UTSW 14 96280077 missense probably benign 0.08
R7467:Klhl1 UTSW 14 96123277 missense probably damaging 1.00
R7483:Klhl1 UTSW 14 96346868 missense probably benign 0.09
R7650:Klhl1 UTSW 14 96346943 missense probably damaging 0.96
R7817:Klhl1 UTSW 14 96136750 missense possibly damaging 0.91
R8221:Klhl1 UTSW 14 96280110 missense possibly damaging 0.69
R8444:Klhl1 UTSW 14 96517890 missense probably benign
R8483:Klhl1 UTSW 14 96381934 missense probably benign
R9100:Klhl1 UTSW 14 96346928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCACGTAGAAAAGAGTCCTGG -3'
(R):5'- TGAGCTGCAGTTCCTTGGTC -3'

Sequencing Primer
(F):5'- AAAGAGTCCTGGCGGGC -3'
(R):5'- GTCCACGGTTCATTAAGCATG -3'
Posted On 2015-04-06