Mutagenetix > Incidental Mutation

Incidental Mutation 'R3874:Klhl1'

276751

Institutional Source

Beutler Lab

Gene Symbol

Klhl1

Ensembl Gene

ENSMUSG00000022076

Gene Name

kelch-like 1

Synonyms

MMRRC Submission

040792-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R3874 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96102736-96519102 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96518179 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 47 (F47L)

Ref Sequence

ENSEMBL: ENSMUSP00000022666 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022666]

AlphaFold

Q9JI74

Predicted Effect

probably benign
Transcript: ENSMUST00000022666
AA Change: F47L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000022666
Gene: ENSMUSG00000022076
AA Change: F47L

Domain	Start	End	E-Value	Type
low complexity region	25	36	N/A	INTRINSIC
low complexity region	74	90	N/A	INTRINSIC
low complexity region	107	119	N/A	INTRINSIC
BTB	215	312	1.13e-28	SMART
BACK	317	418	5.03e-34	SMART
Kelch	463	509	8.86e-10	SMART
Kelch	510	556	1.04e-15	SMART
Kelch	557	603	6.76e-15	SMART
Kelch	604	650	2.23e-15	SMART
Kelch	651	703	3.09e-9	SMART
Kelch	704	750	3.43e-16	SMART

Meta Mutation Damage Score

0.0896

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The KLHL1 protein belongs to a family of actin-organizing proteins related to Drosophila Kelch (Nemes et al., 2000 [PubMed 10888605]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice both homozygous and heterozygous for disruption of this gene develop abnormalities in gait and defects in motor coordination with time. Dendritic atrophy of Purkinje cells is also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130213A22Rik	C	A	11: 69,121,475	G26*	probably null	Het
Abca5	T	A	11: 110,310,233	Y447F	probably damaging	Het
Acox2	A	G	14: 8,248,061	I407T	probably benign	Het
Adam8	T	C	7: 139,987,607	N408D	probably damaging	Het
Adgre1	A	T	17: 57,401,925	T39S	probably benign	Het
Akap12	G	A	10: 4,357,590	V1467I	probably benign	Het
Arid1b	T	A	17: 5,336,515		probably null	Het
Atp2c2	A	G	8: 119,735,296	I303V	possibly damaging	Het
Bpifc	C	T	10: 85,991,254	V144I	probably benign	Het
C530008M17Rik	A	G	5: 76,840,892	D30G	probably damaging	Het
Camk4	A	G	18: 33,158,854	E189G	possibly damaging	Het
Casz1	A	G	4: 148,939,589		probably benign	Het
Ccdc134	T	C	15: 82,131,442	V41A	possibly damaging	Het
Chrd	A	T	16: 20,738,910	T753S	probably damaging	Het
Cyb561a3	T	C	19: 10,585,371	V125A	probably benign	Het
D630039A03Rik	T	A	4: 57,910,606	T69S	probably benign	Het
Dchs1	A	G	7: 105,761,635	F1687S	probably damaging	Het
Dlgap4	T	C	2: 156,749,347	S818P	probably benign	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Dnaic2	G	T	11: 114,732,955	G15W	probably damaging	Het
Dsg1c	A	G	18: 20,277,052	I526V	probably benign	Het
Far2	G	A	6: 148,150,591	E123K	probably benign	Het
Gli1	A	T	10: 127,330,219	V1055E	probably damaging	Het
Hand2	G	T	8: 57,321,976	A24S	probably benign	Het
Helb	T	C	10: 120,106,037	I249V	probably benign	Het
Hspa4l	G	A	3: 40,772,642	V492M	probably damaging	Het
Hspg2	T	C	4: 137,539,349	I1916T	probably damaging	Het
Igfals	G	A	17: 24,881,605	V557I	possibly damaging	Het
Itpa	T	G	2: 130,681,010	S176A	probably damaging	Het
Kcnu1	T	A	8: 25,885,317	L353H	probably damaging	Het
Klhl13	T	C	X: 23,285,176	D21G	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Krt9	C	T	11: 100,190,849	V285I	probably damaging	Het
Mansc1	T	C	6: 134,610,183	R344G	possibly damaging	Het
Mier2	G	T	10: 79,541,797	P439T	possibly damaging	Het
Mppe1	T	A	18: 67,225,886		probably null	Het
Nedd4l	G	A	18: 65,167,535	A243T	probably benign	Het
Notch4	T	A	17: 34,578,069	C934*	probably null	Het
Nsmce3	C	T	7: 64,872,168	D251N	probably damaging	Het
Olfr101	T	A	17: 37,299,979	T148S	probably benign	Het
Olfr1156	T	A	2: 87,949,530	R234S	probably damaging	Het
Olfr1310	T	C	2: 112,008,323	T288A	possibly damaging	Het
Olfr139	A	G	11: 74,044,699	C192R	probably damaging	Het
Olfr517	C	T	7: 108,869,128	V9M	probably damaging	Het
Olfr937	A	G	9: 39,060,174	I164T	probably benign	Het
Pdzd7	T	C	19: 45,045,628	T6A	probably benign	Het
Picalm	T	A	7: 90,189,219	F493Y	probably damaging	Het
Prl7d1	A	G	13: 27,716,668	M1T	probably null	Het
Prl8a1	T	C	13: 27,575,458	K199E	possibly damaging	Het
Rims1	C	T	1: 22,428,489	R764H	probably damaging	Het
Rnf17	G	T	14: 56,475,413	R779L	possibly damaging	Het
Rufy2	T	C	10: 62,998,137	L294P	probably damaging	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Slc22a30	G	T	19: 8,336,849	T491K	probably benign	Het
Slc35b3	T	C	13: 38,943,068	N20D	possibly damaging	Het
Slc5a4a	T	C	10: 76,181,655	F429L	probably benign	Het
Sulf1	T	C	1: 12,817,412	I270T	probably damaging	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tnc	T	A	4: 64,008,710	I860F	probably damaging	Het
Trh	A	T	6: 92,243,698	V61E	possibly damaging	Het
Ttn	T	G	2: 76,754,099	T22222P	probably damaging	Het
Uroc1	A	T	6: 90,361,512	K652*	probably null	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r120	A	T	17: 57,524,954	F278L	probably benign	Het
Vmn2r7	A	G	3: 64,719,611	F86L	possibly damaging	Het
Vmn2r87	A	T	10: 130,479,987	I70K	possibly damaging	Het
Vps13a	C	T	19: 16,744,953	A332T	probably benign	Het
Zfp568	T	A	7: 30,023,396	C589S	probably damaging	Het

Other mutations in Klhl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01573:Klhl1	APN	14	96201204	splice site	probably benign
IGL02055:Klhl1	APN	14	96280103	missense	possibly damaging	0.96
IGL02110:Klhl1	APN	14	96136603	missense	probably benign	0.27
IGL02216:Klhl1	APN	14	96123222	missense	probably benign	0.08
IGL02307:Klhl1	APN	14	96201373	missense	possibly damaging	0.68
IGL02538:Klhl1	APN	14	96240213	missense	probably benign	0.03
IGL02559:Klhl1	APN	14	96151960	missense	possibly damaging	0.95
IGL02682:Klhl1	APN	14	96201342	missense	possibly damaging	0.83
IGL03228:Klhl1	APN	14	96240327	missense	probably damaging	1.00
LCD18:Klhl1	UTSW	14	96317730	intron	probably benign
P0041:Klhl1	UTSW	14	96280211	missense	probably damaging	1.00
R0270:Klhl1	UTSW	14	96518344	start gained	probably benign
R0419:Klhl1	UTSW	14	96381789	missense	probably benign	0.30
R0938:Klhl1	UTSW	14	96152040	nonsense	probably null
R1465:Klhl1	UTSW	14	96240213	missense	probably benign	0.03
R1465:Klhl1	UTSW	14	96240213	missense	probably benign	0.03
R1590:Klhl1	UTSW	14	96368636	missense	probably damaging	1.00
R1597:Klhl1	UTSW	14	96201211	critical splice donor site	probably null
R1893:Klhl1	UTSW	14	96240206	critical splice donor site	probably null
R1928:Klhl1	UTSW	14	96346789	missense	probably benign	0.02
R2272:Klhl1	UTSW	14	96517908	missense	probably benign	0.00
R3612:Klhl1	UTSW	14	96381770	critical splice donor site	probably null
R3852:Klhl1	UTSW	14	96280205	missense	probably benign	0.12
R3872:Klhl1	UTSW	14	96518179	missense	probably benign	0.03
R3923:Klhl1	UTSW	14	96346880	missense	possibly damaging	0.46
R3925:Klhl1	UTSW	14	96346880	missense	possibly damaging	0.46
R3926:Klhl1	UTSW	14	96346880	missense	possibly damaging	0.46
R4151:Klhl1	UTSW	14	96518316	start codon destroyed	probably null	0.73
R4502:Klhl1	UTSW	14	96517846	missense	probably benign
R4536:Klhl1	UTSW	14	96136583	critical splice donor site	probably null
R4729:Klhl1	UTSW	14	96280148	missense	probably damaging	1.00
R4756:Klhl1	UTSW	14	96151966	missense	probably benign	0.39
R5001:Klhl1	UTSW	14	96136610	missense	probably damaging	0.96
R5022:Klhl1	UTSW	14	96136706	missense	probably benign	0.31
R5616:Klhl1	UTSW	14	96518293	missense	probably benign	0.44
R5634:Klhl1	UTSW	14	96240271	missense	probably damaging	0.96
R5700:Klhl1	UTSW	14	96518040	missense	probably benign
R5701:Klhl1	UTSW	14	96201380	missense	probably benign
R5934:Klhl1	UTSW	14	96123215	critical splice donor site	probably null
R5950:Klhl1	UTSW	14	96240354	missense	probably damaging	0.99
R6454:Klhl1	UTSW	14	96280091	missense	possibly damaging	0.66
R6496:Klhl1	UTSW	14	96240216	missense	probably benign	0.03
R6606:Klhl1	UTSW	14	96123222	missense	possibly damaging	0.52
R6644:Klhl1	UTSW	14	96517918	missense	probably benign
R6745:Klhl1	UTSW	14	96280002	critical splice donor site	probably null
R6919:Klhl1	UTSW	14	96136594	missense	probably benign	0.00
R7029:Klhl1	UTSW	14	96518196	missense	probably benign	0.01
R7195:Klhl1	UTSW	14	96280077	missense	probably benign	0.08
R7467:Klhl1	UTSW	14	96123277	missense	probably damaging	1.00
R7483:Klhl1	UTSW	14	96346868	missense	probably benign	0.09
R7650:Klhl1	UTSW	14	96346943	missense	probably damaging	0.96
R7817:Klhl1	UTSW	14	96136750	missense	possibly damaging	0.91
R8221:Klhl1	UTSW	14	96280110	missense	possibly damaging	0.69
R8444:Klhl1	UTSW	14	96517890	missense	probably benign
R8483:Klhl1	UTSW	14	96381934	missense	probably benign
R9100:Klhl1	UTSW	14	96346928	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCCACGTAGAAAAGAGTCCTGG -3'
(R):5'- TGAGCTGCAGTTCCTTGGTC -3'

Sequencing Primer
(F):5'- AAAGAGTCCTGGCGGGC -3'
(R):5'- GTCCACGGTTCATTAAGCATG -3'

Posted On

2015-04-06