Incidental Mutation 'R3874:Ccdc134'
ID 276752
Institutional Source Beutler Lab
Gene Symbol Ccdc134
Ensembl Gene ENSMUSG00000068114
Gene Name coiled-coil domain containing 134
Synonyms 2310042L06Rik
MMRRC Submission 040792-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R3874 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 82012123-82026404 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82015643 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 41 (V41A)
Ref Sequence ENSEMBL: ENSMUSP00000155805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089174] [ENSMUST00000089178] [ENSMUST00000186125] [ENSMUST00000188048] [ENSMUST00000189540] [ENSMUST00000229119] [ENSMUST00000229597] [ENSMUST00000229411] [ENSMUST00000229384]
AlphaFold Q8C7V8
Predicted Effect probably benign
Transcript: ENSMUST00000089174
AA Change: V41A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000086578
Gene: ENSMUSG00000068114
AA Change: V41A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ERK-JNK_inhib 23 223 1.7e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089178
SMART Domains Protein: ENSMUSP00000086582
Gene: ENSMUSG00000068117

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
SCOP:d1gw5a_ 123 498 1e-3 SMART
low complexity region 956 966 N/A INTRINSIC
low complexity region 1025 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186125
Predicted Effect probably benign
Transcript: ENSMUST00000188048
SMART Domains Protein: ENSMUSP00000139689
Gene: ENSMUSG00000068117

DomainStartEndE-ValueType
low complexity region 523 536 N/A INTRINSIC
low complexity region 595 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189540
SMART Domains Protein: ENSMUSP00000140479
Gene: ENSMUSG00000068117

DomainStartEndE-ValueType
low complexity region 523 536 N/A INTRINSIC
low complexity region 595 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229119
Predicted Effect possibly damaging
Transcript: ENSMUST00000229597
AA Change: V41A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000229411
AA Change: V41A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229788
Predicted Effect probably benign
Transcript: ENSMUST00000229384
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality during organogenesis with impaired liver and vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,012,301 (GRCm39) G26* probably null Het
Abca5 T A 11: 110,201,059 (GRCm39) Y447F probably damaging Het
Acox2 A G 14: 8,248,061 (GRCm38) I407T probably benign Het
Adam8 T C 7: 139,567,520 (GRCm39) N408D probably damaging Het
Adgre1 A T 17: 57,708,925 (GRCm39) T39S probably benign Het
Akap12 G A 10: 4,307,590 (GRCm39) V1467I probably benign Het
Arid1b T A 17: 5,386,790 (GRCm39) probably null Het
Atp2c2 A G 8: 120,462,035 (GRCm39) I303V possibly damaging Het
Bpifc C T 10: 85,827,118 (GRCm39) V144I probably benign Het
Camk4 A G 18: 33,291,907 (GRCm39) E189G possibly damaging Het
Casz1 A G 4: 149,024,046 (GRCm39) probably benign Het
Chrd A T 16: 20,557,660 (GRCm39) T753S probably damaging Het
Cracd A G 5: 76,988,739 (GRCm39) D30G probably damaging Het
Cyb561a3 T C 19: 10,562,735 (GRCm39) V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 (GRCm39) T69S probably benign Het
Dchs1 A G 7: 105,410,842 (GRCm39) F1687S probably damaging Het
Dlgap4 T C 2: 156,591,267 (GRCm39) S818P probably benign Het
Dnah2 A G 11: 69,320,174 (GRCm39) I3965T probably damaging Het
Dnai2 G T 11: 114,623,781 (GRCm39) G15W probably damaging Het
Dsg1c A G 18: 20,410,109 (GRCm39) I526V probably benign Het
Far2 G A 6: 148,052,089 (GRCm39) E123K probably benign Het
Gli1 A T 10: 127,166,088 (GRCm39) V1055E probably damaging Het
Hand2 G T 8: 57,775,011 (GRCm39) A24S probably benign Het
Helb T C 10: 119,941,942 (GRCm39) I249V probably benign Het
Hspa4l G A 3: 40,727,074 (GRCm39) V492M probably damaging Het
Hspg2 T C 4: 137,266,660 (GRCm39) I1916T probably damaging Het
Igfals G A 17: 25,100,579 (GRCm39) V557I possibly damaging Het
Itpa T G 2: 130,522,930 (GRCm39) S176A probably damaging Het
Kcnu1 T A 8: 26,375,345 (GRCm39) L353H probably damaging Het
Klhl1 A G 14: 96,755,615 (GRCm39) F47L probably benign Het
Klhl13 T C X: 23,151,415 (GRCm39) D21G probably benign Het
Krt26 T C 11: 99,225,570 (GRCm39) K304E probably damaging Het
Krt9 C T 11: 100,081,675 (GRCm39) V285I probably damaging Het
Mansc1 T C 6: 134,587,146 (GRCm39) R344G possibly damaging Het
Mier2 G T 10: 79,377,631 (GRCm39) P439T possibly damaging Het
Mppe1 T A 18: 67,358,957 (GRCm39) probably null Het
Nedd4l G A 18: 65,300,606 (GRCm39) A243T probably benign Het
Notch4 T A 17: 34,797,043 (GRCm39) C934* probably null Het
Nsmce3 C T 7: 64,521,916 (GRCm39) D251N probably damaging Het
Or10a49 C T 7: 108,468,335 (GRCm39) V9M probably damaging Het
Or12d12 T A 17: 37,610,870 (GRCm39) T148S probably benign Het
Or3a10 A G 11: 73,935,525 (GRCm39) C192R probably damaging Het
Or4f6 T C 2: 111,838,668 (GRCm39) T288A possibly damaging Het
Or5l13 T A 2: 87,779,874 (GRCm39) R234S probably damaging Het
Or8g23 A G 9: 38,971,470 (GRCm39) I164T probably benign Het
Pdzd7 T C 19: 45,034,067 (GRCm39) T6A probably benign Het
Picalm T A 7: 89,838,427 (GRCm39) F493Y probably damaging Het
Prl7d1 A G 13: 27,900,651 (GRCm39) M1T probably null Het
Prl8a1 T C 13: 27,759,441 (GRCm39) K199E possibly damaging Het
Rims1 C T 1: 22,498,740 (GRCm39) R764H probably damaging Het
Rnf17 G T 14: 56,712,870 (GRCm39) R779L possibly damaging Het
Rufy2 T C 10: 62,833,916 (GRCm39) L294P probably damaging Het
Sgsh A G 11: 119,241,773 (GRCm39) L111P probably damaging Het
Slc22a30 G T 19: 8,314,213 (GRCm39) T491K probably benign Het
Slc35b3 T C 13: 39,127,044 (GRCm39) N20D possibly damaging Het
Slc5a4a T C 10: 76,017,489 (GRCm39) F429L probably benign Het
Sulf1 T C 1: 12,887,636 (GRCm39) I270T probably damaging Het
Tmem51 T C 4: 141,759,059 (GRCm39) T230A probably damaging Het
Tnc T A 4: 63,926,947 (GRCm39) I860F probably damaging Het
Trh A T 6: 92,220,679 (GRCm39) V61E possibly damaging Het
Ttn T G 2: 76,584,443 (GRCm39) T22222P probably damaging Het
Uroc1 A T 6: 90,338,494 (GRCm39) K652* probably null Het
Usp34 C T 11: 23,439,033 (GRCm39) P3532S possibly damaging Het
Vmn2r120 A T 17: 57,831,954 (GRCm39) F278L probably benign Het
Vmn2r7 A G 3: 64,627,032 (GRCm39) F86L possibly damaging Het
Vmn2r87 A T 10: 130,315,856 (GRCm39) I70K possibly damaging Het
Vps13a C T 19: 16,722,317 (GRCm39) A332T probably benign Het
Zfp568 T A 7: 29,722,821 (GRCm39) C589S probably damaging Het
Other mutations in Ccdc134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02746:Ccdc134 APN 15 82,015,938 (GRCm39) intron probably benign
IGL02941:Ccdc134 APN 15 82,025,151 (GRCm39) missense probably damaging 0.98
IGL03071:Ccdc134 APN 15 82,018,826 (GRCm39) missense possibly damaging 0.71
IGL03278:Ccdc134 APN 15 82,015,682 (GRCm39) missense possibly damaging 0.56
IGL03308:Ccdc134 APN 15 82,015,721 (GRCm39) missense probably damaging 1.00
IGL03014:Ccdc134 UTSW 15 82,014,306 (GRCm39) missense probably damaging 0.99
R0077:Ccdc134 UTSW 15 82,015,938 (GRCm39) intron probably benign
R0243:Ccdc134 UTSW 15 82,025,147 (GRCm39) missense probably damaging 0.98
R1107:Ccdc134 UTSW 15 82,018,895 (GRCm39) missense probably damaging 1.00
R1107:Ccdc134 UTSW 15 82,018,892 (GRCm39) missense possibly damaging 0.92
R1588:Ccdc134 UTSW 15 82,019,337 (GRCm39) missense probably benign 0.03
R6696:Ccdc134 UTSW 15 82,015,722 (GRCm39) missense probably damaging 1.00
R7448:Ccdc134 UTSW 15 82,025,149 (GRCm39) missense possibly damaging 0.64
R7814:Ccdc134 UTSW 15 82,015,724 (GRCm39) missense probably damaging 0.96
R8088:Ccdc134 UTSW 15 82,015,990 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- GCCGACGCTACAGTTGAAAC -3'
(R):5'- AGAGAACCCTTCCTCTGTGC -3'

Sequencing Primer
(F):5'- CGCTACAGTTGAAACAGGTTGCTG -3'
(R):5'- TGTGCTCCAACTGAAGCC -3'
Posted On 2015-04-06