Incidental Mutation 'R3874:Notch4'
ID 276757
Institutional Source Beutler Lab
Gene Symbol Notch4
Ensembl Gene ENSMUSG00000015468
Gene Name notch 4
Synonyms Int3, N4, Int-3
MMRRC Submission 040792-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3874 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34564268-34588503 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 34578069 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 934 (C934*)
Ref Sequence ENSEMBL: ENSMUSP00000133574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015612] [ENSMUST00000173389]
AlphaFold P31695
Predicted Effect probably null
Transcript: ENSMUST00000015612
AA Change: C930*
SMART Domains Protein: ENSMUSP00000015612
Gene: ENSMUSG00000015468
AA Change: C930*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 24 60 3.2e-4 SMART
EGF 64 112 1.07e-5 SMART
EGF 118 152 5.49e-3 SMART
EGF 156 189 9.33e-6 SMART
EGF_CA 191 229 1.42e-10 SMART
EGF 234 271 1.11e-3 SMART
EGF 276 309 1.84e-4 SMART
EGF_CA 311 350 2.52e-11 SMART
EGF_CA 352 388 1.85e-9 SMART
EGF 392 427 1.58e-3 SMART
EGF_CA 429 470 2.46e-14 SMART
EGF_CA 472 508 5.03e-11 SMART
EGF_CA 510 546 6.74e-12 SMART
EGF_CA 548 584 2.98e-13 SMART
EGF_CA 586 622 7.63e-11 SMART
EGF_like 645 686 2.86e1 SMART
EGF 691 724 3.48e-5 SMART
EGF 729 762 3.62e-3 SMART
EGF_CA 764 800 1.48e-8 SMART
EGF 806 839 1.74e-5 SMART
EGF 844 877 2.3e-5 SMART
EGF 881 924 3.59e-7 SMART
EGF_CA 926 962 7.29e-8 SMART
EGF_CA 965 1000 4.42e-7 SMART
EGF_CA 1002 1040 4.56e-9 SMART
EGF 1045 1081 6.16e-6 SMART
EGF 1086 1122 8.65e-1 SMART
EGF 1129 1167 1.45e-2 SMART
NL 1159 1200 6.79e-13 SMART
NL 1203 1242 2.01e-15 SMART
NL 1243 1281 1.85e-14 SMART
NOD 1287 1341 4.37e-8 SMART
NODP 1373 1437 2.12e-6 SMART
transmembrane domain 1441 1463 N/A INTRINSIC
low complexity region 1525 1539 N/A INTRINSIC
ANK 1578 1623 2.5e3 SMART
ANK 1628 1657 1.12e-3 SMART
ANK 1661 1691 5.01e-1 SMART
ANK 1695 1724 1.65e-1 SMART
ANK 1728 1757 4.56e-4 SMART
ANK 1761 1790 2.88e-1 SMART
low complexity region 1889 1906 N/A INTRINSIC
low complexity region 1925 1937 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173389
AA Change: C934*
SMART Domains Protein: ENSMUSP00000133574
Gene: ENSMUSG00000015468
AA Change: C934*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 28 64 3.2e-4 SMART
EGF 68 116 1.07e-5 SMART
EGF 122 156 5.49e-3 SMART
EGF 160 193 9.33e-6 SMART
EGF_CA 195 233 1.42e-10 SMART
EGF 238 275 1.11e-3 SMART
EGF 280 313 1.84e-4 SMART
EGF_CA 315 354 2.52e-11 SMART
EGF_CA 356 392 1.85e-9 SMART
EGF 396 431 1.58e-3 SMART
EGF_CA 433 474 2.46e-14 SMART
EGF_CA 476 512 5.03e-11 SMART
EGF_CA 514 550 6.74e-12 SMART
EGF_CA 552 588 2.98e-13 SMART
EGF_CA 590 626 7.63e-11 SMART
EGF_like 649 690 2.86e1 SMART
EGF 695 728 3.48e-5 SMART
EGF 733 766 3.62e-3 SMART
EGF_CA 768 804 1.48e-8 SMART
EGF 810 843 1.74e-5 SMART
EGF 848 881 2.3e-5 SMART
EGF 885 928 3.59e-7 SMART
EGF_like 930 955 7.02e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174707
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor may play a role in vascular, renal and hepatic development. Mutations in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a slight delay in postnatal retinal angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 (GRCm38) G26* probably null Het
Abca5 T A 11: 110,310,233 (GRCm38) Y447F probably damaging Het
Acox2 A G 14: 8,248,061 (GRCm38) I407T probably benign Het
Adam8 T C 7: 139,987,607 (GRCm38) N408D probably damaging Het
Adgre1 A T 17: 57,401,925 (GRCm38) T39S probably benign Het
Akap12 G A 10: 4,357,590 (GRCm38) V1467I probably benign Het
Arid1b T A 17: 5,336,515 (GRCm38) probably null Het
Atp2c2 A G 8: 119,735,296 (GRCm38) I303V possibly damaging Het
Bpifc C T 10: 85,991,254 (GRCm38) V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 (GRCm38) D30G probably damaging Het
Camk4 A G 18: 33,158,854 (GRCm38) E189G possibly damaging Het
Casz1 A G 4: 148,939,589 (GRCm38) probably benign Het
Ccdc134 T C 15: 82,131,442 (GRCm38) V41A possibly damaging Het
Chrd A T 16: 20,738,910 (GRCm38) T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 (GRCm38) V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 (GRCm38) T69S probably benign Het
Dchs1 A G 7: 105,761,635 (GRCm38) F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 (GRCm38) S818P probably benign Het
Dnah2 A G 11: 69,429,348 (GRCm38) I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 (GRCm38) G15W probably damaging Het
Dsg1c A G 18: 20,277,052 (GRCm38) I526V probably benign Het
Far2 G A 6: 148,150,591 (GRCm38) E123K probably benign Het
Gli1 A T 10: 127,330,219 (GRCm38) V1055E probably damaging Het
Hand2 G T 8: 57,321,976 (GRCm38) A24S probably benign Het
Helb T C 10: 120,106,037 (GRCm38) I249V probably benign Het
Hspa4l G A 3: 40,772,642 (GRCm38) V492M probably damaging Het
Hspg2 T C 4: 137,539,349 (GRCm38) I1916T probably damaging Het
Igfals G A 17: 24,881,605 (GRCm38) V557I possibly damaging Het
Itpa T G 2: 130,681,010 (GRCm38) S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 (GRCm38) L353H probably damaging Het
Klhl1 A G 14: 96,518,179 (GRCm38) F47L probably benign Het
Klhl13 T C X: 23,285,176 (GRCm38) D21G probably benign Het
Krt26 T C 11: 99,334,744 (GRCm38) K304E probably damaging Het
Krt9 C T 11: 100,190,849 (GRCm38) V285I probably damaging Het
Mansc1 T C 6: 134,610,183 (GRCm38) R344G possibly damaging Het
Mier2 G T 10: 79,541,797 (GRCm38) P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 (GRCm38) probably null Het
Nedd4l G A 18: 65,167,535 (GRCm38) A243T probably benign Het
Nsmce3 C T 7: 64,872,168 (GRCm38) D251N probably damaging Het
Olfr101 T A 17: 37,299,979 (GRCm38) T148S probably benign Het
Olfr1156 T A 2: 87,949,530 (GRCm38) R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 (GRCm38) T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 (GRCm38) C192R probably damaging Het
Olfr517 C T 7: 108,869,128 (GRCm38) V9M probably damaging Het
Olfr937 A G 9: 39,060,174 (GRCm38) I164T probably benign Het
Pdzd7 T C 19: 45,045,628 (GRCm38) T6A probably benign Het
Picalm T A 7: 90,189,219 (GRCm38) F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 (GRCm38) M1T probably null Het
Prl8a1 T C 13: 27,575,458 (GRCm38) K199E possibly damaging Het
Rims1 C T 1: 22,428,489 (GRCm38) R764H probably damaging Het
Rnf17 G T 14: 56,475,413 (GRCm38) R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 (GRCm38) L294P probably damaging Het
Sgsh A G 11: 119,350,947 (GRCm38) L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 (GRCm38) T491K probably benign Het
Slc35b3 T C 13: 38,943,068 (GRCm38) N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 (GRCm38) F429L probably benign Het
Sulf1 T C 1: 12,817,412 (GRCm38) I270T probably damaging Het
Tmem51 T C 4: 142,031,748 (GRCm38) T230A probably damaging Het
Tnc T A 4: 64,008,710 (GRCm38) I860F probably damaging Het
Trh A T 6: 92,243,698 (GRCm38) V61E possibly damaging Het
Ttn T G 2: 76,754,099 (GRCm38) T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 (GRCm38) K652* probably null Het
Usp34 C T 11: 23,489,033 (GRCm38) P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 (GRCm38) F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 (GRCm38) F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 (GRCm38) I70K possibly damaging Het
Vps13a C T 19: 16,744,953 (GRCm38) A332T probably benign Het
Zfp568 T A 7: 30,023,396 (GRCm38) C589S probably damaging Het
Other mutations in Notch4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Notch4 APN 17 34,575,561 (GRCm38) critical splice donor site probably null
IGL01022:Notch4 APN 17 34,565,697 (GRCm38) missense probably damaging 1.00
IGL01356:Notch4 APN 17 34,581,026 (GRCm38) missense possibly damaging 0.67
IGL01634:Notch4 APN 17 34,572,588 (GRCm38) missense probably damaging 1.00
IGL02150:Notch4 APN 17 34,584,613 (GRCm38) missense probably damaging 1.00
IGL02248:Notch4 APN 17 34,587,198 (GRCm38) missense probably damaging 1.00
IGL02271:Notch4 APN 17 34,568,471 (GRCm38) missense probably damaging 1.00
IGL02299:Notch4 APN 17 34,578,004 (GRCm38) missense probably damaging 1.00
IGL02561:Notch4 APN 17 34,568,160 (GRCm38) splice site probably benign
IGL02604:Notch4 APN 17 34,565,388 (GRCm38) splice site probably null
IGL03323:Notch4 APN 17 34,582,471 (GRCm38) missense probably damaging 1.00
IGL03366:Notch4 APN 17 34,572,568 (GRCm38) missense probably damaging 1.00
IGL03408:Notch4 APN 17 34,565,568 (GRCm38) missense probably benign 0.03
K3955:Notch4 UTSW 17 34,568,462 (GRCm38) missense probably damaging 1.00
R0123:Notch4 UTSW 17 34,565,363 (GRCm38) missense possibly damaging 0.85
R0366:Notch4 UTSW 17 34,581,499 (GRCm38) splice site probably benign
R0446:Notch4 UTSW 17 34,565,363 (GRCm38) missense possibly damaging 0.85
R0490:Notch4 UTSW 17 34,582,890 (GRCm38) missense probably damaging 1.00
R0504:Notch4 UTSW 17 34,575,091 (GRCm38) missense probably damaging 1.00
R0545:Notch4 UTSW 17 34,583,433 (GRCm38) missense probably damaging 1.00
R0702:Notch4 UTSW 17 34,575,203 (GRCm38) missense probably damaging 1.00
R0763:Notch4 UTSW 17 34,565,332 (GRCm38) nonsense probably null
R0854:Notch4 UTSW 17 34,568,572 (GRCm38) missense probably damaging 1.00
R1082:Notch4 UTSW 17 34,587,390 (GRCm38) missense probably damaging 1.00
R1196:Notch4 UTSW 17 34,568,863 (GRCm38) missense probably damaging 1.00
R1316:Notch4 UTSW 17 34,567,470 (GRCm38) missense probably damaging 1.00
R1493:Notch4 UTSW 17 34,567,682 (GRCm38) nonsense probably null
R1527:Notch4 UTSW 17 34,565,744 (GRCm38) missense probably damaging 1.00
R1548:Notch4 UTSW 17 34,568,422 (GRCm38) missense probably damaging 1.00
R1718:Notch4 UTSW 17 34,576,763 (GRCm38) splice site probably benign
R1855:Notch4 UTSW 17 34,580,962 (GRCm38) missense probably benign 0.05
R1988:Notch4 UTSW 17 34,587,588 (GRCm38) missense possibly damaging 0.59
R2022:Notch4 UTSW 17 34,587,528 (GRCm38) missense probably damaging 1.00
R2023:Notch4 UTSW 17 34,587,528 (GRCm38) missense probably damaging 1.00
R2078:Notch4 UTSW 17 34,568,715 (GRCm38) critical splice acceptor site probably null
R2369:Notch4 UTSW 17 34,585,950 (GRCm38) missense probably benign 0.15
R3846:Notch4 UTSW 17 34,578,097 (GRCm38) missense probably damaging 1.00
R4087:Notch4 UTSW 17 34,584,435 (GRCm38) missense probably damaging 1.00
R4456:Notch4 UTSW 17 34,583,833 (GRCm38) missense probably damaging 0.99
R4628:Notch4 UTSW 17 34,570,185 (GRCm38) missense probably damaging 1.00
R4728:Notch4 UTSW 17 34,570,205 (GRCm38) missense probably benign 0.00
R4778:Notch4 UTSW 17 34,582,511 (GRCm38) missense possibly damaging 0.95
R4818:Notch4 UTSW 17 34,578,716 (GRCm38) splice site probably benign
R4828:Notch4 UTSW 17 34,570,060 (GRCm38) missense probably damaging 1.00
R4830:Notch4 UTSW 17 34,570,118 (GRCm38) missense probably damaging 1.00
R4859:Notch4 UTSW 17 34,587,180 (GRCm38) missense probably damaging 1.00
R4871:Notch4 UTSW 17 34,577,562 (GRCm38) missense possibly damaging 0.63
R5090:Notch4 UTSW 17 34,580,920 (GRCm38) missense probably damaging 0.99
R5290:Notch4 UTSW 17 34,565,289 (GRCm38) missense probably benign 0.01
R5363:Notch4 UTSW 17 34,587,123 (GRCm38) missense probably damaging 1.00
R5860:Notch4 UTSW 17 34,582,418 (GRCm38) missense probably damaging 1.00
R6352:Notch4 UTSW 17 34,567,461 (GRCm38) missense probably damaging 1.00
R6385:Notch4 UTSW 17 34,573,814 (GRCm38) missense probably null 0.16
R6422:Notch4 UTSW 17 34,584,559 (GRCm38) missense probably benign
R6645:Notch4 UTSW 17 34,587,816 (GRCm38) missense probably benign 0.00
R6836:Notch4 UTSW 17 34,586,100 (GRCm38) missense probably damaging 0.96
R6943:Notch4 UTSW 17 34,583,603 (GRCm38) missense probably benign
R6991:Notch4 UTSW 17 34,584,800 (GRCm38) nonsense probably null
R7078:Notch4 UTSW 17 34,582,546 (GRCm38) missense possibly damaging 0.94
R7168:Notch4 UTSW 17 34,572,693 (GRCm38) missense probably benign 0.05
R7182:Notch4 UTSW 17 34,583,499 (GRCm38) missense probably damaging 1.00
R7240:Notch4 UTSW 17 34,576,471 (GRCm38) missense probably benign 0.00
R7247:Notch4 UTSW 17 34,572,517 (GRCm38) missense probably damaging 1.00
R7556:Notch4 UTSW 17 34,575,470 (GRCm38) missense probably damaging 1.00
R7571:Notch4 UTSW 17 34,583,574 (GRCm38) missense probably damaging 0.99
R7697:Notch4 UTSW 17 34,570,185 (GRCm38) missense probably damaging 1.00
R7763:Notch4 UTSW 17 34,582,418 (GRCm38) missense probably damaging 1.00
R7994:Notch4 UTSW 17 34,578,090 (GRCm38) missense possibly damaging 0.82
R8139:Notch4 UTSW 17 34,584,800 (GRCm38) nonsense probably null
R8171:Notch4 UTSW 17 34,582,509 (GRCm38) nonsense probably null
R8375:Notch4 UTSW 17 34,568,254 (GRCm38) missense possibly damaging 0.90
R8448:Notch4 UTSW 17 34,586,789 (GRCm38) splice site probably null
R8543:Notch4 UTSW 17 34,568,420 (GRCm38) missense probably damaging 1.00
R8776:Notch4 UTSW 17 34,587,605 (GRCm38) missense probably damaging 1.00
R8776-TAIL:Notch4 UTSW 17 34,587,605 (GRCm38) missense probably damaging 1.00
R8847:Notch4 UTSW 17 34,584,988 (GRCm38) splice site probably benign
R8885:Notch4 UTSW 17 34,584,496 (GRCm38) missense possibly damaging 0.94
R9126:Notch4 UTSW 17 34,581,106 (GRCm38) missense probably benign 0.00
R9184:Notch4 UTSW 17 34,587,390 (GRCm38) missense probably damaging 1.00
R9425:Notch4 UTSW 17 34,576,827 (GRCm38) missense probably benign 0.42
R9434:Notch4 UTSW 17 34,582,699 (GRCm38) missense probably damaging 1.00
R9462:Notch4 UTSW 17 34,587,693 (GRCm38) missense probably benign 0.00
R9664:Notch4 UTSW 17 34,565,627 (GRCm38) missense probably benign 0.07
R9772:Notch4 UTSW 17 34,573,909 (GRCm38) critical splice donor site probably null
X0054:Notch4 UTSW 17 34,584,495 (GRCm38) missense probably damaging 1.00
X0067:Notch4 UTSW 17 34,586,084 (GRCm38) nonsense probably null
Z1088:Notch4 UTSW 17 34,587,915 (GRCm38) missense probably damaging 1.00
Z1177:Notch4 UTSW 17 34,587,909 (GRCm38) missense probably benign 0.04
Z1177:Notch4 UTSW 17 34,587,908 (GRCm38) missense probably damaging 0.97
Z1177:Notch4 UTSW 17 34,575,148 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCACAGTCTCTTGTGGAAC -3'
(R):5'- AGCATAGGGAAGTTCTTATGAGGTG -3'

Sequencing Primer
(F):5'- TGGAACACTCTGGGTCAGG -3'
(R):5'- AAGTTCTTATGAGGTGGCATGGC -3'
Posted On 2015-04-06