Incidental Mutation 'R3874:Olfr101'
ID 276758
Institutional Source Beutler Lab
Gene Symbol Olfr101
Ensembl Gene ENSMUSG00000092077
Gene Name olfactory receptor 101
Synonyms GA_x6K02T2PSCP-1761617-1760691, MOR250-2
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R3874 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 37297556-37304313 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37299979 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 148 (T148S)
Ref Sequence ENSEMBL: ENSMUSP00000149851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058046] [ENSMUST00000214376] [ENSMUST00000215392]
AlphaFold Q920Z0
Predicted Effect probably benign
Transcript: ENSMUST00000058046
AA Change: T148S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000061042
Gene: ENSMUSG00000092077
AA Change: T148S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.3e-53 PFAM
Pfam:7tm_1 39 289 3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214376
AA Change: T148S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000215392
AA Change: T148S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Olfr101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Olfr101 APN 17 37299738 missense probably benign 0.00
IGL01584:Olfr101 APN 17 37299738 missense probably benign 0.00
IGL01609:Olfr101 APN 17 37299738 missense probably benign 0.00
IGL01739:Olfr101 APN 17 37299782 missense probably benign 0.00
IGL03203:Olfr101 APN 17 37300426 splice site probably benign
R1122:Olfr101 UTSW 17 37300128 missense probably damaging 1.00
R1132:Olfr101 UTSW 17 37299532 missense probably benign 0.19
R1237:Olfr101 UTSW 17 37300265 missense probably benign 0.19
R3423:Olfr101 UTSW 17 37299870 missense probably benign 0.00
R3872:Olfr101 UTSW 17 37299979 missense probably benign 0.00
R3873:Olfr101 UTSW 17 37299979 missense probably benign 0.00
R4871:Olfr101 UTSW 17 37300204 missense probably benign 0.03
R5213:Olfr101 UTSW 17 37300051 missense probably damaging 0.98
R5974:Olfr101 UTSW 17 37300338 missense possibly damaging 0.65
R6294:Olfr101 UTSW 17 37299553 missense probably benign 0.02
R8784:Olfr101 UTSW 17 37299810 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GTGGAGCATGCTGCAAGAAC -3'
(R):5'- TCTTGGGATGCATAACTCAGC -3'

Sequencing Primer
(F):5'- CATGCTGCAAGAACGGGTC -3'
(R):5'- GGGATGCATAACTCAGCTTCATTTC -3'
Posted On 2015-04-06