Mutagenetix > Incidental Mutations

Incidental Mutation 'R3874:Adgre1'

276759

Institutional Source

Beutler Lab

Gene Symbol

Adgre1

Ensembl Gene

ENSMUSG00000004730

Gene Name

adhesion G protein-coupled receptor E1

Synonyms

Emr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71

MMRRC Submission

040792-MU

Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R3874 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57358686-57483529 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 57401925 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 39 (T39S)

Ref Sequence

ENSEMBL: ENSMUSP00000083971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]

AlphaFold

Q61549

Predicted Effect

probably benign
Transcript: ENSMUST00000004850
AA Change: T39S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: T39S

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
EGF	35	80	1.43e-1	SMART
EGF_CA	81	122	3.59e-7	SMART
EGF_CA	133	172	4.56e-9	SMART
EGF_CA	173	221	1.29e-8	SMART
EGF_CA	222	271	2.31e-10	SMART
EGF_CA	272	318	1.06e-9	SMART
EGF_CA	319	367	1.18e-7	SMART
GPS	591	641	2.57e-19	SMART
Pfam:7tm_2	644	885	2.1e-63	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000086763
AA Change: T39S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: T39S

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
EGF	35	80	1.43e-1	SMART
EGF_CA	81	122	3.59e-7	SMART
EGF_CA	133	172	4.56e-9	SMART
EGF_CA	173	221	1.29e-8	SMART
EGF_CA	222	271	2.31e-10	SMART
EGF_CA	272	318	1.06e-9	SMART
EGF_CA	319	367	1.18e-7	SMART
GPS	591	641	2.57e-19	SMART
Pfam:7tm_2	644	885	2.1e-63	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130213A22Rik	C	A	11: 69,121,475	G26*	probably null	Het
Abca5	T	A	11: 110,310,233	Y447F	probably damaging	Het
Acox2	A	G	14: 8,248,061	I407T	probably benign	Het
Adam8	T	C	7: 139,987,607	N408D	probably damaging	Het
Akap12	G	A	10: 4,357,590	V1467I	probably benign	Het
Arid1b	T	A	17: 5,336,515		probably null	Het
Atp2c2	A	G	8: 119,735,296	I303V	possibly damaging	Het
Bpifc	C	T	10: 85,991,254	V144I	probably benign	Het
C530008M17Rik	A	G	5: 76,840,892	D30G	probably damaging	Het
Camk4	A	G	18: 33,158,854	E189G	possibly damaging	Het
Casz1	A	G	4: 148,939,589		probably benign	Het
Ccdc134	T	C	15: 82,131,442	V41A	possibly damaging	Het
Chrd	A	T	16: 20,738,910	T753S	probably damaging	Het
Cyb561a3	T	C	19: 10,585,371	V125A	probably benign	Het
D630039A03Rik	T	A	4: 57,910,606	T69S	probably benign	Het
Dchs1	A	G	7: 105,761,635	F1687S	probably damaging	Het
Dlgap4	T	C	2: 156,749,347	S818P	probably benign	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Dnaic2	G	T	11: 114,732,955	G15W	probably damaging	Het
Dsg1c	A	G	18: 20,277,052	I526V	probably benign	Het
Far2	G	A	6: 148,150,591	E123K	probably benign	Het
Gli1	A	T	10: 127,330,219	V1055E	probably damaging	Het
Hand2	G	T	8: 57,321,976	A24S	probably benign	Het
Helb	T	C	10: 120,106,037	I249V	probably benign	Het
Hspa4l	G	A	3: 40,772,642	V492M	probably damaging	Het
Hspg2	T	C	4: 137,539,349	I1916T	probably damaging	Het
Igfals	G	A	17: 24,881,605	V557I	possibly damaging	Het
Itpa	T	G	2: 130,681,010	S176A	probably damaging	Het
Kcnu1	T	A	8: 25,885,317	L353H	probably damaging	Het
Klhl1	A	G	14: 96,518,179	F47L	probably benign	Het
Klhl13	T	C	X: 23,285,176	D21G	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Krt9	C	T	11: 100,190,849	V285I	probably damaging	Het
Mansc1	T	C	6: 134,610,183	R344G	possibly damaging	Het
Mier2	G	T	10: 79,541,797	P439T	possibly damaging	Het
Mppe1	T	A	18: 67,225,886		probably null	Het
Nedd4l	G	A	18: 65,167,535	A243T	probably benign	Het
Notch4	T	A	17: 34,578,069	C934*	probably null	Het
Nsmce3	C	T	7: 64,872,168	D251N	probably damaging	Het
Olfr101	T	A	17: 37,299,979	T148S	probably benign	Het
Olfr1156	T	A	2: 87,949,530	R234S	probably damaging	Het
Olfr1310	T	C	2: 112,008,323	T288A	possibly damaging	Het
Olfr139	A	G	11: 74,044,699	C192R	probably damaging	Het
Olfr517	C	T	7: 108,869,128	V9M	probably damaging	Het
Olfr937	A	G	9: 39,060,174	I164T	probably benign	Het
Pdzd7	T	C	19: 45,045,628	T6A	probably benign	Het
Picalm	T	A	7: 90,189,219	F493Y	probably damaging	Het
Prl7d1	A	G	13: 27,716,668	M1T	probably null	Het
Prl8a1	T	C	13: 27,575,458	K199E	possibly damaging	Het
Rims1	C	T	1: 22,428,489	R764H	probably damaging	Het
Rnf17	G	T	14: 56,475,413	R779L	possibly damaging	Het
Rufy2	T	C	10: 62,998,137	L294P	probably damaging	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Slc22a30	G	T	19: 8,336,849	T491K	probably benign	Het
Slc35b3	T	C	13: 38,943,068	N20D	possibly damaging	Het
Slc5a4a	T	C	10: 76,181,655	F429L	probably benign	Het
Sulf1	T	C	1: 12,817,412	I270T	probably damaging	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tnc	T	A	4: 64,008,710	I860F	probably damaging	Het
Trh	A	T	6: 92,243,698	V61E	possibly damaging	Het
Ttn	T	G	2: 76,754,099	T22222P	probably damaging	Het
Uroc1	A	T	6: 90,361,512	K652*	probably null	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r120	A	T	17: 57,524,954	F278L	probably benign	Het
Vmn2r7	A	G	3: 64,719,611	F86L	possibly damaging	Het
Vmn2r87	A	T	10: 130,479,987	I70K	possibly damaging	Het
Vps13a	C	T	19: 16,744,953	A332T	probably benign	Het
Zfp568	T	A	7: 30,023,396	C589S	probably damaging	Het

Other mutations in Adgre1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Adgre1	APN	17	57450055	missense	probably benign	0.00
IGL00966:Adgre1	APN	17	57419335	missense	probably benign	0.04
IGL01680:Adgre1	APN	17	57402620	missense	unknown
IGL01724:Adgre1	APN	17	57444064	nonsense	probably null
IGL02172:Adgre1	APN	17	57478879	missense	probably damaging	1.00
IGL02260:Adgre1	APN	17	57447891	missense	probably benign	0.01
IGL02272:Adgre1	APN	17	57450021	nonsense	probably null
IGL02336:Adgre1	APN	17	57411024	nonsense	probably null
IGL02346:Adgre1	APN	17	57443919	missense	probably benign	0.15
IGL02398:Adgre1	APN	17	57402824	nonsense	probably null
IGL02618:Adgre1	APN	17	57444021	missense	possibly damaging	0.66
IGL02690:Adgre1	APN	17	57480921	missense	probably damaging	1.00
IGL02936:Adgre1	APN	17	57478833	missense	probably benign	0.26
IGL03112:Adgre1	APN	17	57448029	splice site	probably null
IGL03350:Adgre1	APN	17	57401908	missense	probably benign	0.16
F480	UTSW	17	57444063	missense	probably damaging	1.00
lomax	UTSW	17	57402811	missense	unknown
Onion	UTSW	17	57402841	nonsense	probably null
Scallion	UTSW	17	57401977	missense	possibly damaging	0.90
R0049:Adgre1	UTSW	17	57402841	nonsense	probably null
R0153:Adgre1	UTSW	17	57443939	missense	possibly damaging	0.92
R0277:Adgre1	UTSW	17	57444060	missense	probably benign	0.00
R0278:Adgre1	UTSW	17	57447872	missense	probably benign	0.07
R0323:Adgre1	UTSW	17	57444060	missense	probably benign	0.00
R0389:Adgre1	UTSW	17	57406839	missense	possibly damaging	0.80
R0492:Adgre1	UTSW	17	57402742	missense	unknown
R0621:Adgre1	UTSW	17	57441359	missense	probably damaging	0.98
R0647:Adgre1	UTSW	17	57411003	missense	probably damaging	1.00
R1310:Adgre1	UTSW	17	57447936	missense	probably benign	0.00
R1601:Adgre1	UTSW	17	57441353	missense	probably benign	0.01
R1689:Adgre1	UTSW	17	57449921	missense	probably benign	0.31
R1708:Adgre1	UTSW	17	57401974	missense	possibly damaging	0.93
R1796:Adgre1	UTSW	17	57441350	missense	probably benign	0.43
R1839:Adgre1	UTSW	17	57441299	missense	probably benign	0.00
R1860:Adgre1	UTSW	17	57441363	missense	probably benign	0.00
R2165:Adgre1	UTSW	17	57419338	missense	probably damaging	0.97
R2219:Adgre1	UTSW	17	57401912	missense	possibly damaging	0.92
R2519:Adgre1	UTSW	17	57410956	missense	probably damaging	1.00
R3911:Adgre1	UTSW	17	57447860	missense	probably damaging	1.00
R4190:Adgre1	UTSW	17	57402811	missense	unknown
R4439:Adgre1	UTSW	17	57447954	missense	probably damaging	1.00
R4513:Adgre1	UTSW	17	57410947	missense	probably benign	0.34
R4529:Adgre1	UTSW	17	57420519	missense	possibly damaging	0.92
R4543:Adgre1	UTSW	17	57406874	missense	probably benign	0.07
R4610:Adgre1	UTSW	17	57450073	missense	possibly damaging	0.50
R4665:Adgre1	UTSW	17	57480947	missense	probably benign	0.20
R4911:Adgre1	UTSW	17	57447832	missense	possibly damaging	0.57
R4928:Adgre1	UTSW	17	57444064	nonsense	probably null
R4942:Adgre1	UTSW	17	57406903	missense	probably damaging	1.00
R4946:Adgre1	UTSW	17	57443918	missense	probably benign	0.33
R4953:Adgre1	UTSW	17	57441321	missense	probably damaging	0.99
R5107:Adgre1	UTSW	17	57401977	missense	possibly damaging	0.90
R5366:Adgre1	UTSW	17	57402817	missense	probably benign	0.39
R5590:Adgre1	UTSW	17	57445034	missense	probably damaging	1.00
R5619:Adgre1	UTSW	17	57420437	missense	probably benign	0.15
R5699:Adgre1	UTSW	17	57481007	missense	probably benign	0.43
R5734:Adgre1	UTSW	17	57443990	missense	probably benign	0.00
R5860:Adgre1	UTSW	17	57445034	missense	probably damaging	1.00
R6039:Adgre1	UTSW	17	57406859	missense	probably benign	0.28
R6039:Adgre1	UTSW	17	57406859	missense	probably benign	0.28
R6149:Adgre1	UTSW	17	57445018	missense	probably benign	0.08
R6478:Adgre1	UTSW	17	57401955	missense	possibly damaging	0.81
R6709:Adgre1	UTSW	17	57406917	missense	probably benign	0.10
R6864:Adgre1	UTSW	17	57478879	missense	probably damaging	1.00
R6945:Adgre1	UTSW	17	57410844	missense	probably benign	0.01
R6945:Adgre1	UTSW	17	57420399	missense	probably benign	0.39
R6988:Adgre1	UTSW	17	57408445	missense	probably benign	0.00
R7019:Adgre1	UTSW	17	57410945	missense	probably damaging	0.98
R7154:Adgre1	UTSW	17	57444087	splice site	probably null
R7347:Adgre1	UTSW	17	57420441	missense	probably damaging	1.00
R7459:Adgre1	UTSW	17	57449933	missense	probably damaging	1.00
R7709:Adgre1	UTSW	17	57402519	missense	unknown
R7939:Adgre1	UTSW	17	57449938	missense	probably damaging	0.98
R7977:Adgre1	UTSW	17	57447987	missense	possibly damaging	0.54
R7987:Adgre1	UTSW	17	57447987	missense	possibly damaging	0.54
R8187:Adgre1	UTSW	17	57420349	missense	probably benign	0.00
R8210:Adgre1	UTSW	17	57445061	missense	possibly damaging	0.94
R8223:Adgre1	UTSW	17	57361692	missense	probably damaging	0.99
R8344:Adgre1	UTSW	17	57408459	missense	probably benign	0.12
R8698:Adgre1	UTSW	17	57402003	missense	probably benign	0.05
R9236:Adgre1	UTSW	17	57402782	nonsense	probably null
R9262:Adgre1	UTSW	17	57447941	missense	probably damaging	1.00
R9303:Adgre1	UTSW	17	57441275	missense	probably benign	0.00
R9305:Adgre1	UTSW	17	57441275	missense	probably benign	0.00
Z1176:Adgre1	UTSW	17	57361729	missense	possibly damaging	0.76
Z1177:Adgre1	UTSW	17	57419374	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTTGTTTCTCACATGGCCAAG -3'
(R):5'- TACACAATTAAGCTGCCTGAGTG -3'

Sequencing Primer
(F):5'- TGGCCAAGACATGCATAAGATCTTC -3'
(R):5'- CACAATTAAGCTGCCTGAGTGTGATG -3'

Posted On

2015-04-06