Incidental Mutation 'R3874:Dsg1c'
ID 276761
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Name desmoglein 1 gamma
Synonyms Dsg6
MMRRC Submission 040792-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3874 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 20380397-20418088 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20410109 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 526 (I526V)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
AlphaFold Q7TSF0
Predicted Effect probably benign
Transcript: ENSMUST00000054128
AA Change: I526V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: I526V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,012,301 (GRCm39) G26* probably null Het
Abca5 T A 11: 110,201,059 (GRCm39) Y447F probably damaging Het
Acox2 A G 14: 8,248,061 (GRCm38) I407T probably benign Het
Adam8 T C 7: 139,567,520 (GRCm39) N408D probably damaging Het
Adgre1 A T 17: 57,708,925 (GRCm39) T39S probably benign Het
Akap12 G A 10: 4,307,590 (GRCm39) V1467I probably benign Het
Arid1b T A 17: 5,386,790 (GRCm39) probably null Het
Atp2c2 A G 8: 120,462,035 (GRCm39) I303V possibly damaging Het
Bpifc C T 10: 85,827,118 (GRCm39) V144I probably benign Het
Camk4 A G 18: 33,291,907 (GRCm39) E189G possibly damaging Het
Casz1 A G 4: 149,024,046 (GRCm39) probably benign Het
Ccdc134 T C 15: 82,015,643 (GRCm39) V41A possibly damaging Het
Chrd A T 16: 20,557,660 (GRCm39) T753S probably damaging Het
Cracd A G 5: 76,988,739 (GRCm39) D30G probably damaging Het
Cyb561a3 T C 19: 10,562,735 (GRCm39) V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 (GRCm39) T69S probably benign Het
Dchs1 A G 7: 105,410,842 (GRCm39) F1687S probably damaging Het
Dlgap4 T C 2: 156,591,267 (GRCm39) S818P probably benign Het
Dnah2 A G 11: 69,320,174 (GRCm39) I3965T probably damaging Het
Dnai2 G T 11: 114,623,781 (GRCm39) G15W probably damaging Het
Far2 G A 6: 148,052,089 (GRCm39) E123K probably benign Het
Gli1 A T 10: 127,166,088 (GRCm39) V1055E probably damaging Het
Hand2 G T 8: 57,775,011 (GRCm39) A24S probably benign Het
Helb T C 10: 119,941,942 (GRCm39) I249V probably benign Het
Hspa4l G A 3: 40,727,074 (GRCm39) V492M probably damaging Het
Hspg2 T C 4: 137,266,660 (GRCm39) I1916T probably damaging Het
Igfals G A 17: 25,100,579 (GRCm39) V557I possibly damaging Het
Itpa T G 2: 130,522,930 (GRCm39) S176A probably damaging Het
Kcnu1 T A 8: 26,375,345 (GRCm39) L353H probably damaging Het
Klhl1 A G 14: 96,755,615 (GRCm39) F47L probably benign Het
Klhl13 T C X: 23,151,415 (GRCm39) D21G probably benign Het
Krt26 T C 11: 99,225,570 (GRCm39) K304E probably damaging Het
Krt9 C T 11: 100,081,675 (GRCm39) V285I probably damaging Het
Mansc1 T C 6: 134,587,146 (GRCm39) R344G possibly damaging Het
Mier2 G T 10: 79,377,631 (GRCm39) P439T possibly damaging Het
Mppe1 T A 18: 67,358,957 (GRCm39) probably null Het
Nedd4l G A 18: 65,300,606 (GRCm39) A243T probably benign Het
Notch4 T A 17: 34,797,043 (GRCm39) C934* probably null Het
Nsmce3 C T 7: 64,521,916 (GRCm39) D251N probably damaging Het
Or10a49 C T 7: 108,468,335 (GRCm39) V9M probably damaging Het
Or12d12 T A 17: 37,610,870 (GRCm39) T148S probably benign Het
Or3a10 A G 11: 73,935,525 (GRCm39) C192R probably damaging Het
Or4f6 T C 2: 111,838,668 (GRCm39) T288A possibly damaging Het
Or5l13 T A 2: 87,779,874 (GRCm39) R234S probably damaging Het
Or8g23 A G 9: 38,971,470 (GRCm39) I164T probably benign Het
Pdzd7 T C 19: 45,034,067 (GRCm39) T6A probably benign Het
Picalm T A 7: 89,838,427 (GRCm39) F493Y probably damaging Het
Prl7d1 A G 13: 27,900,651 (GRCm39) M1T probably null Het
Prl8a1 T C 13: 27,759,441 (GRCm39) K199E possibly damaging Het
Rims1 C T 1: 22,498,740 (GRCm39) R764H probably damaging Het
Rnf17 G T 14: 56,712,870 (GRCm39) R779L possibly damaging Het
Rufy2 T C 10: 62,833,916 (GRCm39) L294P probably damaging Het
Sgsh A G 11: 119,241,773 (GRCm39) L111P probably damaging Het
Slc22a30 G T 19: 8,314,213 (GRCm39) T491K probably benign Het
Slc35b3 T C 13: 39,127,044 (GRCm39) N20D possibly damaging Het
Slc5a4a T C 10: 76,017,489 (GRCm39) F429L probably benign Het
Sulf1 T C 1: 12,887,636 (GRCm39) I270T probably damaging Het
Tmem51 T C 4: 141,759,059 (GRCm39) T230A probably damaging Het
Tnc T A 4: 63,926,947 (GRCm39) I860F probably damaging Het
Trh A T 6: 92,220,679 (GRCm39) V61E possibly damaging Het
Ttn T G 2: 76,584,443 (GRCm39) T22222P probably damaging Het
Uroc1 A T 6: 90,338,494 (GRCm39) K652* probably null Het
Usp34 C T 11: 23,439,033 (GRCm39) P3532S possibly damaging Het
Vmn2r120 A T 17: 57,831,954 (GRCm39) F278L probably benign Het
Vmn2r7 A G 3: 64,627,032 (GRCm39) F86L possibly damaging Het
Vmn2r87 A T 10: 130,315,856 (GRCm39) I70K possibly damaging Het
Vps13a C T 19: 16,722,317 (GRCm39) A332T probably benign Het
Zfp568 T A 7: 29,722,821 (GRCm39) C589S probably damaging Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20,407,733 (GRCm39) missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20,414,899 (GRCm39) splice site probably benign
IGL01412:Dsg1c APN 18 20,380,518 (GRCm39) missense probably benign
IGL02037:Dsg1c APN 18 20,410,007 (GRCm39) missense probably benign 0.02
IGL02247:Dsg1c APN 18 20,397,373 (GRCm39) missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20,410,056 (GRCm39) missense probably benign
IGL02408:Dsg1c APN 18 20,407,776 (GRCm39) missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20,416,790 (GRCm39) missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20,408,249 (GRCm39) missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20,407,887 (GRCm39) missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20,400,986 (GRCm39) missense probably benign 0.07
IGL03335:Dsg1c APN 18 20,416,754 (GRCm39) missense probably benign 0.01
Nancy UTSW 18 20,416,171 (GRCm39) missense probably damaging 1.00
R0385:Dsg1c UTSW 18 20,416,711 (GRCm39) missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20,407,832 (GRCm39) missense probably benign 0.04
R0570:Dsg1c UTSW 18 20,403,435 (GRCm39) missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20,412,298 (GRCm39) missense probably benign 0.02
R0621:Dsg1c UTSW 18 20,412,752 (GRCm39) missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20,405,403 (GRCm39) splice site probably benign
R1183:Dsg1c UTSW 18 20,416,255 (GRCm39) missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20,415,080 (GRCm39) missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20,415,104 (GRCm39) missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20,397,899 (GRCm39) missense probably benign 0.36
R1623:Dsg1c UTSW 18 20,408,234 (GRCm39) missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20,416,096 (GRCm39) splice site probably null
R1881:Dsg1c UTSW 18 20,405,597 (GRCm39) splice site probably benign
R2017:Dsg1c UTSW 18 20,399,253 (GRCm39) missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20,408,309 (GRCm39) missense probably benign 0.09
R2319:Dsg1c UTSW 18 20,408,235 (GRCm39) missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20,400,945 (GRCm39) missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20,403,407 (GRCm39) missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20,415,115 (GRCm39) critical splice donor site probably null
R3910:Dsg1c UTSW 18 20,399,253 (GRCm39) missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20,408,322 (GRCm39) missense probably benign 0.01
R4739:Dsg1c UTSW 18 20,408,246 (GRCm39) missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20,397,901 (GRCm39) missense probably benign 0.00
R5165:Dsg1c UTSW 18 20,410,080 (GRCm39) missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20,407,758 (GRCm39) missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20,405,436 (GRCm39) missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20,400,994 (GRCm39) missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20,416,703 (GRCm39) missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20,415,088 (GRCm39) missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20,405,568 (GRCm39) missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20,416,270 (GRCm39) missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20,405,408 (GRCm39) missense probably benign 0.06
R5889:Dsg1c UTSW 18 20,416,658 (GRCm39) missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20,407,687 (GRCm39) missense probably benign 0.01
R6596:Dsg1c UTSW 18 20,403,581 (GRCm39) splice site probably null
R6941:Dsg1c UTSW 18 20,400,980 (GRCm39) missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20,399,201 (GRCm39) missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20,410,066 (GRCm39) missense probably benign
R7240:Dsg1c UTSW 18 20,416,166 (GRCm39) missense probably damaging 1.00
R8048:Dsg1c UTSW 18 20,407,824 (GRCm39) missense probably damaging 1.00
R8092:Dsg1c UTSW 18 20,415,029 (GRCm39) missense probably damaging 1.00
R8103:Dsg1c UTSW 18 20,416,171 (GRCm39) missense probably damaging 1.00
R8117:Dsg1c UTSW 18 20,410,016 (GRCm39) missense probably benign
R8192:Dsg1c UTSW 18 20,399,255 (GRCm39) missense probably damaging 1.00
R8801:Dsg1c UTSW 18 20,410,022 (GRCm39) missense probably benign 0.00
R9059:Dsg1c UTSW 18 20,408,306 (GRCm39) missense probably damaging 1.00
R9152:Dsg1c UTSW 18 20,416,329 (GRCm39) missense probably benign 0.06
R9292:Dsg1c UTSW 18 20,416,775 (GRCm39) missense probably damaging 1.00
R9469:Dsg1c UTSW 18 20,400,947 (GRCm39) missense probably damaging 1.00
R9596:Dsg1c UTSW 18 20,416,361 (GRCm39) missense probably benign 0.17
R9619:Dsg1c UTSW 18 20,416,499 (GRCm39) missense probably damaging 1.00
R9628:Dsg1c UTSW 18 20,397,373 (GRCm39) missense probably damaging 1.00
R9710:Dsg1c UTSW 18 20,410,044 (GRCm39) missense probably benign
X0026:Dsg1c UTSW 18 20,416,315 (GRCm39) missense probably damaging 1.00
Z1176:Dsg1c UTSW 18 20,416,630 (GRCm39) missense probably damaging 1.00
Z1177:Dsg1c UTSW 18 20,398,006 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTACAGATTCCCTTCAGAGG -3'
(R):5'- TGTTGTGGCCCCAGATGTAC -3'

Sequencing Primer
(F):5'- AGATTCCCTTCAGAGGACCTG -3'
(R):5'- TTGTGGCCCCAGATGTACCATAG -3'
Posted On 2015-04-06