Incidental Mutation 'R3874:Slc22a30'
ID276765
Institutional Source Beutler Lab
Gene Symbol Slc22a30
Ensembl Gene ENSMUSG00000052562
Gene Namesolute carrier family 22, member 30
Synonyms
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3874 (G1)
Quality Score145
Status Not validated
Chromosome19
Chromosomal Location8335371-8405111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8336849 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 491 (T491K)
Ref Sequence ENSEMBL: ENSMUSP00000093988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269]
Predicted Effect probably benign
Transcript: ENSMUST00000064507
SMART Domains Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 439 3.1e-21 PFAM
Pfam:MFS_1 127 433 8.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096269
AA Change: T491K

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562
AA Change: T491K

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 9.6e-27 PFAM
Pfam:MFS_1 140 376 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Slc22a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Slc22a30 APN 19 8335788 missense probably benign 0.29
IGL01894:Slc22a30 APN 19 8386657 missense probably benign 0.28
IGL02795:Slc22a30 APN 19 8400895 missense probably damaging 1.00
IGL02798:Slc22a30 APN 19 8370085 missense probably damaging 0.96
IGL03267:Slc22a30 APN 19 8337958 missense probably benign 0.00
R0089:Slc22a30 UTSW 19 8370197 missense probably benign 0.03
R0243:Slc22a30 UTSW 19 8345357 missense probably benign 0.01
R1033:Slc22a30 UTSW 19 8335801 nonsense probably null
R1781:Slc22a30 UTSW 19 8335772 missense probably damaging 1.00
R2098:Slc22a30 UTSW 19 8400811 missense probably damaging 1.00
R4091:Slc22a30 UTSW 19 8404545 missense probably damaging 1.00
R4799:Slc22a30 UTSW 19 8344404 missense probably benign
R5108:Slc22a30 UTSW 19 8386426 missense probably damaging 1.00
R5191:Slc22a30 UTSW 19 8344393 nonsense probably null
R5192:Slc22a30 UTSW 19 8344393 nonsense probably null
R5193:Slc22a30 UTSW 19 8344393 nonsense probably null
R5195:Slc22a30 UTSW 19 8344393 nonsense probably null
R5253:Slc22a30 UTSW 19 8344393 nonsense probably null
R5254:Slc22a30 UTSW 19 8344393 nonsense probably null
R5255:Slc22a30 UTSW 19 8344393 nonsense probably null
R5256:Slc22a30 UTSW 19 8344393 nonsense probably null
R5377:Slc22a30 UTSW 19 8344393 nonsense probably null
R5378:Slc22a30 UTSW 19 8344393 nonsense probably null
R5400:Slc22a30 UTSW 19 8344393 nonsense probably null
R5401:Slc22a30 UTSW 19 8344393 nonsense probably null
R5481:Slc22a30 UTSW 19 8336837 missense probably benign 0.01
R5644:Slc22a30 UTSW 19 8404616 missense possibly damaging 0.72
R5679:Slc22a30 UTSW 19 8335771 missense possibly damaging 0.90
R5699:Slc22a30 UTSW 19 8344393 nonsense probably null
R5704:Slc22a30 UTSW 19 8344393 nonsense probably null
R5706:Slc22a30 UTSW 19 8344393 nonsense probably null
R5767:Slc22a30 UTSW 19 8344393 nonsense probably null
R5770:Slc22a30 UTSW 19 8386527 missense probably damaging 0.99
R5784:Slc22a30 UTSW 19 8344393 nonsense probably null
R5793:Slc22a30 UTSW 19 8336819 missense possibly damaging 0.95
R5813:Slc22a30 UTSW 19 8404581 missense probably benign 0.07
R6101:Slc22a30 UTSW 19 8337868 splice site probably null
R6105:Slc22a30 UTSW 19 8337868 splice site probably null
R6327:Slc22a30 UTSW 19 8335722 utr 3 prime probably benign
R6958:Slc22a30 UTSW 19 8386701 missense probably damaging 0.98
R7162:Slc22a30 UTSW 19 8336717 splice site probably null
R7375:Slc22a30 UTSW 19 8404691 missense probably damaging 1.00
R7572:Slc22a30 UTSW 19 8335708 missense unknown
R7755:Slc22a30 UTSW 19 8336769 missense probably damaging 1.00
R8114:Slc22a30 UTSW 19 8404540 nonsense probably null
R8248:Slc22a30 UTSW 19 8370199 missense probably benign 0.12
Z1088:Slc22a30 UTSW 19 8335775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCAGCATAGTCCATTAGC -3'
(R):5'- TGTCTTCATGGTCTGAATCTGAC -3'

Sequencing Primer
(F):5'- GCATAGTCCATTAGCAAACAACTC -3'
(R):5'- AGGAAGAGTAAGTTACCAAGATCC -3'
Posted On2015-04-06