Mutagenetix > Incidental Mutation

Incidental Mutation 'R3874:Slc22a30'

276765

Institutional Source

Beutler Lab

Gene Symbol

Slc22a30

Ensembl Gene

ENSMUSG00000052562

Gene Name

solute carrier family 22, member 30

Synonyms

MMRRC Submission

040792-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R3874 (G1)

Quality Score

145

Status

Not validated

Chromosome

Chromosomal Location

8335371-8405111 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 8336849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 491 (T491K)

Ref Sequence

ENSEMBL: ENSMUSP00000093988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269]

AlphaFold

Q96LX3

Predicted Effect

probably benign
Transcript: ENSMUST00000064507

SMART Domains

Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Sugar_tr	99	439	3.1e-21	PFAM
Pfam:MFS_1	127	433	8.8e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000096269
AA Change: T491K

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562
AA Change: T491K

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Sugar_tr	99	527	9.6e-27	PFAM
Pfam:MFS_1	140	376	1.2e-15	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130213A22Rik	C	A	11: 69,121,475	G26*	probably null	Het
Abca5	T	A	11: 110,310,233	Y447F	probably damaging	Het
Acox2	A	G	14: 8,248,061	I407T	probably benign	Het
Adam8	T	C	7: 139,987,607	N408D	probably damaging	Het
Adgre1	A	T	17: 57,401,925	T39S	probably benign	Het
Akap12	G	A	10: 4,357,590	V1467I	probably benign	Het
Arid1b	T	A	17: 5,336,515		probably null	Het
Atp2c2	A	G	8: 119,735,296	I303V	possibly damaging	Het
Bpifc	C	T	10: 85,991,254	V144I	probably benign	Het
C530008M17Rik	A	G	5: 76,840,892	D30G	probably damaging	Het
Camk4	A	G	18: 33,158,854	E189G	possibly damaging	Het
Casz1	A	G	4: 148,939,589		probably benign	Het
Ccdc134	T	C	15: 82,131,442	V41A	possibly damaging	Het
Chrd	A	T	16: 20,738,910	T753S	probably damaging	Het
Cyb561a3	T	C	19: 10,585,371	V125A	probably benign	Het
D630039A03Rik	T	A	4: 57,910,606	T69S	probably benign	Het
Dchs1	A	G	7: 105,761,635	F1687S	probably damaging	Het
Dlgap4	T	C	2: 156,749,347	S818P	probably benign	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Dnaic2	G	T	11: 114,732,955	G15W	probably damaging	Het
Dsg1c	A	G	18: 20,277,052	I526V	probably benign	Het
Far2	G	A	6: 148,150,591	E123K	probably benign	Het
Gli1	A	T	10: 127,330,219	V1055E	probably damaging	Het
Hand2	G	T	8: 57,321,976	A24S	probably benign	Het
Helb	T	C	10: 120,106,037	I249V	probably benign	Het
Hspa4l	G	A	3: 40,772,642	V492M	probably damaging	Het
Hspg2	T	C	4: 137,539,349	I1916T	probably damaging	Het
Igfals	G	A	17: 24,881,605	V557I	possibly damaging	Het
Itpa	T	G	2: 130,681,010	S176A	probably damaging	Het
Kcnu1	T	A	8: 25,885,317	L353H	probably damaging	Het
Klhl1	A	G	14: 96,518,179	F47L	probably benign	Het
Klhl13	T	C	X: 23,285,176	D21G	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Krt9	C	T	11: 100,190,849	V285I	probably damaging	Het
Mansc1	T	C	6: 134,610,183	R344G	possibly damaging	Het
Mier2	G	T	10: 79,541,797	P439T	possibly damaging	Het
Mppe1	T	A	18: 67,225,886		probably null	Het
Nedd4l	G	A	18: 65,167,535	A243T	probably benign	Het
Notch4	T	A	17: 34,578,069	C934*	probably null	Het
Nsmce3	C	T	7: 64,872,168	D251N	probably damaging	Het
Olfr101	T	A	17: 37,299,979	T148S	probably benign	Het
Olfr1156	T	A	2: 87,949,530	R234S	probably damaging	Het
Olfr1310	T	C	2: 112,008,323	T288A	possibly damaging	Het
Olfr139	A	G	11: 74,044,699	C192R	probably damaging	Het
Olfr517	C	T	7: 108,869,128	V9M	probably damaging	Het
Olfr937	A	G	9: 39,060,174	I164T	probably benign	Het
Pdzd7	T	C	19: 45,045,628	T6A	probably benign	Het
Picalm	T	A	7: 90,189,219	F493Y	probably damaging	Het
Prl7d1	A	G	13: 27,716,668	M1T	probably null	Het
Prl8a1	T	C	13: 27,575,458	K199E	possibly damaging	Het
Rims1	C	T	1: 22,428,489	R764H	probably damaging	Het
Rnf17	G	T	14: 56,475,413	R779L	possibly damaging	Het
Rufy2	T	C	10: 62,998,137	L294P	probably damaging	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Slc35b3	T	C	13: 38,943,068	N20D	possibly damaging	Het
Slc5a4a	T	C	10: 76,181,655	F429L	probably benign	Het
Sulf1	T	C	1: 12,817,412	I270T	probably damaging	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tnc	T	A	4: 64,008,710	I860F	probably damaging	Het
Trh	A	T	6: 92,243,698	V61E	possibly damaging	Het
Ttn	T	G	2: 76,754,099	T22222P	probably damaging	Het
Uroc1	A	T	6: 90,361,512	K652*	probably null	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r120	A	T	17: 57,524,954	F278L	probably benign	Het
Vmn2r7	A	G	3: 64,719,611	F86L	possibly damaging	Het
Vmn2r87	A	T	10: 130,479,987	I70K	possibly damaging	Het
Vps13a	C	T	19: 16,744,953	A332T	probably benign	Het
Zfp568	T	A	7: 30,023,396	C589S	probably damaging	Het

Other mutations in Slc22a30

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Slc22a30	APN	19	8335788	missense	probably benign	0.29
IGL01894:Slc22a30	APN	19	8386657	missense	probably benign	0.28
IGL02795:Slc22a30	APN	19	8400895	missense	probably damaging	1.00
IGL02798:Slc22a30	APN	19	8370085	missense	probably damaging	0.96
IGL03267:Slc22a30	APN	19	8337958	missense	probably benign	0.00
R0089:Slc22a30	UTSW	19	8370197	missense	probably benign	0.03
R0243:Slc22a30	UTSW	19	8345357	missense	probably benign	0.01
R1033:Slc22a30	UTSW	19	8335801	nonsense	probably null
R1781:Slc22a30	UTSW	19	8335772	missense	probably damaging	1.00
R2098:Slc22a30	UTSW	19	8400811	missense	probably damaging	1.00
R4091:Slc22a30	UTSW	19	8404545	missense	probably damaging	1.00
R4799:Slc22a30	UTSW	19	8344404	missense	probably benign
R5108:Slc22a30	UTSW	19	8386426	missense	probably damaging	1.00
R5191:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5192:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5193:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5195:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5253:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5254:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5255:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5256:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5377:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5378:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5400:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5401:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5481:Slc22a30	UTSW	19	8336837	missense	probably benign	0.01
R5644:Slc22a30	UTSW	19	8404616	missense	possibly damaging	0.72
R5679:Slc22a30	UTSW	19	8335771	missense	possibly damaging	0.90
R5699:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5704:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5706:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5767:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5770:Slc22a30	UTSW	19	8386527	missense	probably damaging	0.99
R5784:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5793:Slc22a30	UTSW	19	8336819	missense	possibly damaging	0.95
R5813:Slc22a30	UTSW	19	8404581	missense	probably benign	0.07
R6101:Slc22a30	UTSW	19	8337868	splice site	probably null
R6105:Slc22a30	UTSW	19	8337868	splice site	probably null
R6327:Slc22a30	UTSW	19	8335722	utr 3 prime	probably benign
R6958:Slc22a30	UTSW	19	8386701	missense	probably damaging	0.98
R7162:Slc22a30	UTSW	19	8336717	splice site	probably null
R7375:Slc22a30	UTSW	19	8404691	missense	probably damaging	1.00
R7572:Slc22a30	UTSW	19	8335708	missense	unknown
R7755:Slc22a30	UTSW	19	8336769	missense	probably damaging	1.00
R8114:Slc22a30	UTSW	19	8404540	nonsense	probably null
R8248:Slc22a30	UTSW	19	8370199	missense	probably benign	0.12
R8677:Slc22a30	UTSW	19	8386671	missense	probably benign	0.21
R8854:Slc22a30	UTSW	19	8386390	critical splice donor site	probably null
R8900:Slc22a30	UTSW	19	8337976	missense	probably damaging	1.00
R9185:Slc22a30	UTSW	19	8344553	missense	probably benign	0.03
R9296:Slc22a30	UTSW	19	8386755	missense	probably benign	0.06
R9463:Slc22a30	UTSW	19	8400895	missense	probably damaging	1.00
R9773:Slc22a30	UTSW	19	8344390	missense	probably benign	0.01
Z1088:Slc22a30	UTSW	19	8335775	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCTCAGCATAGTCCATTAGC -3'
(R):5'- TGTCTTCATGGTCTGAATCTGAC -3'

Sequencing Primer
(F):5'- GCATAGTCCATTAGCAAACAACTC -3'
(R):5'- AGGAAGAGTAAGTTACCAAGATCC -3'

Posted On

2015-04-06