Mutagenetix > Incidental Mutations

Incidental Mutation 'R3874:Vps13a'

276767

Institutional Source

Beutler Lab

Gene Symbol

Vps13a

Ensembl Gene

ENSMUSG00000046230

Gene Name

vacuolar protein sorting 13A

Synonyms

4930516E05Rik, 4930543C13Rik, D330038K10Rik

MMRRC Submission

040792-MU

Accession Numbers

Ncbi RefSeq: NM_173028.4; MGI:2444304

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3874 (G1)

Quality Score

199

Status

Not validated

Chromosome

Chromosomal Location

16615366-16780933 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 16744953 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 332 (A332T)

Ref Sequence

ENSEMBL: ENSMUSP00000153129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068156] [ENSMUST00000224149]

Predicted Effect

probably benign
Transcript: ENSMUST00000068156
AA Change: A332T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000068716
Gene: ENSMUSG00000046230
AA Change: A332T

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	5.4e-38	PFAM
Pfam:VPS13	139	371	3.7e-64	PFAM
low complexity region	553	563	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	567	791	1.4e-69	PFAM
Pfam:VPS13_mid_rpt	1138	1329	2e-10	PFAM
low complexity region	1367	1377	N/A	INTRINSIC
Blast:INB	1575	1855	1e-149	BLAST
Pfam:SHR-BD	2200	2449	1.3e-35	PFAM
low complexity region	2510	2521	N/A	INTRINSIC
low complexity region	2632	2648	N/A	INTRINSIC
low complexity region	2719	2731	N/A	INTRINSIC
Pfam:VPS13_C	2755	2935	8.9e-66	PFAM
Pfam:ATG_C	2938	3029	1.6e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223846

Predicted Effect

probably benign
Transcript: ENSMUST00000224149
AA Change: A332T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224428

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225079

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

Strain: 3531502
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may control steps in the cycling of proteins through the trans-Golgi network to endosomes, lysosomes and the plasma membrane. Mutations in this gene cause the autosomal recessive disorder, chorea-acanthocytosis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele display motor dysfunction and abnormal social interaction, hematologic anomalies including acanthocytosis, selective atrophy of the striatum with significant apoptosis and gliosis, and reduced homovanillic acid levels in midbrain. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(5)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130213A22Rik	C	A	11: 69,121,475	G26*	probably null	Het
Abca5	T	A	11: 110,310,233	Y447F	probably damaging	Het
Acox2	A	G	14: 8,248,061	I407T	probably benign	Het
Adam8	T	C	7: 139,987,607	N408D	probably damaging	Het
Adgre1	A	T	17: 57,401,925	T39S	probably benign	Het
Akap12	G	A	10: 4,357,590	V1467I	probably benign	Het
Arid1b	T	A	17: 5,336,515		probably null	Het
Atp2c2	A	G	8: 119,735,296	I303V	possibly damaging	Het
Bpifc	C	T	10: 85,991,254	V144I	probably benign	Het
C530008M17Rik	A	G	5: 76,840,892	D30G	probably damaging	Het
Camk4	A	G	18: 33,158,854	E189G	possibly damaging	Het
Casz1	A	G	4: 148,939,589		probably benign	Het
Ccdc134	T	C	15: 82,131,442	V41A	possibly damaging	Het
Chrd	A	T	16: 20,738,910	T753S	probably damaging	Het
Cyb561a3	T	C	19: 10,585,371	V125A	probably benign	Het
D630039A03Rik	T	A	4: 57,910,606	T69S	probably benign	Het
Dchs1	A	G	7: 105,761,635	F1687S	probably damaging	Het
Dlgap4	T	C	2: 156,749,347	S818P	probably benign	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Dnaic2	G	T	11: 114,732,955	G15W	probably damaging	Het
Dsg1c	A	G	18: 20,277,052	I526V	probably benign	Het
Far2	G	A	6: 148,150,591	E123K	probably benign	Het
Gli1	A	T	10: 127,330,219	V1055E	probably damaging	Het
Hand2	G	T	8: 57,321,976	A24S	probably benign	Het
Helb	T	C	10: 120,106,037	I249V	probably benign	Het
Hspa4l	G	A	3: 40,772,642	V492M	probably damaging	Het
Hspg2	T	C	4: 137,539,349	I1916T	probably damaging	Het
Igfals	G	A	17: 24,881,605	V557I	possibly damaging	Het
Itpa	T	G	2: 130,681,010	S176A	probably damaging	Het
Kcnu1	T	A	8: 25,885,317	L353H	probably damaging	Het
Klhl1	A	G	14: 96,518,179	F47L	probably benign	Het
Klhl13	T	C	X: 23,285,176	D21G	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Krt9	C	T	11: 100,190,849	V285I	probably damaging	Het
Mansc1	T	C	6: 134,610,183	R344G	possibly damaging	Het
Mier2	G	T	10: 79,541,797	P439T	possibly damaging	Het
Mppe1	T	A	18: 67,225,886		probably null	Het
Nedd4l	G	A	18: 65,167,535	A243T	probably benign	Het
Notch4	T	A	17: 34,578,069	C934*	probably null	Het
Nsmce3	C	T	7: 64,872,168	D251N	probably damaging	Het
Olfr101	T	A	17: 37,299,979	T148S	probably benign	Het
Olfr1156	T	A	2: 87,949,530	R234S	probably damaging	Het
Olfr1310	T	C	2: 112,008,323	T288A	possibly damaging	Het
Olfr139	A	G	11: 74,044,699	C192R	probably damaging	Het
Olfr517	C	T	7: 108,869,128	V9M	probably damaging	Het
Olfr937	A	G	9: 39,060,174	I164T	probably benign	Het
Pdzd7	T	C	19: 45,045,628	T6A	probably benign	Het
Picalm	T	A	7: 90,189,219	F493Y	probably damaging	Het
Prl7d1	A	G	13: 27,716,668	M1T	probably null	Het
Prl8a1	T	C	13: 27,575,458	K199E	possibly damaging	Het
Rims1	C	T	1: 22,428,489	R764H	probably damaging	Het
Rnf17	G	T	14: 56,475,413	R779L	possibly damaging	Het
Rufy2	T	C	10: 62,998,137	L294P	probably damaging	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Slc22a30	G	T	19: 8,336,849	T491K	probably benign	Het
Slc35b3	T	C	13: 38,943,068	N20D	possibly damaging	Het
Slc5a4a	T	C	10: 76,181,655	F429L	probably benign	Het
Sulf1	T	C	1: 12,817,412	I270T	probably damaging	Het
Tmem51	T	C	4: 142,031,748	T230A	probably damaging	Het
Tnc	T	A	4: 64,008,710	I860F	probably damaging	Het
Trh	A	T	6: 92,243,698	V61E	possibly damaging	Het
Ttn	T	G	2: 76,754,099	T22222P	probably damaging	Het
Uroc1	A	T	6: 90,361,512	K652*	probably null	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vmn2r120	A	T	17: 57,524,954	F278L	probably benign	Het
Vmn2r7	A	G	3: 64,719,611	F86L	possibly damaging	Het
Vmn2r87	A	T	10: 130,479,987	I70K	possibly damaging	Het
Zfp568	T	A	7: 30,023,396	C589S	probably damaging	Het

Other mutations in Vps13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Vps13a	APN	19	16752175	missense	probably damaging	0.98
IGL00537:Vps13a	APN	19	16680045	missense	probably benign	0.03
IGL00562:Vps13a	APN	19	16734714	critical splice donor site	probably null
IGL00563:Vps13a	APN	19	16734714	critical splice donor site	probably null
IGL00579:Vps13a	APN	19	16707362	missense	probably benign	0.29
IGL00662:Vps13a	APN	19	16704540	missense	probably damaging	0.96
IGL00667:Vps13a	APN	19	16759676	missense	probably damaging	1.00
IGL01102:Vps13a	APN	19	16651417	critical splice donor site	probably null
IGL01139:Vps13a	APN	19	16640625	missense	probably damaging	0.99
IGL01142:Vps13a	APN	19	16687115	missense	possibly damaging	0.86
IGL01361:Vps13a	APN	19	16743007	missense	probably damaging	1.00
IGL01386:Vps13a	APN	19	16701152	missense	possibly damaging	0.87
IGL01593:Vps13a	APN	19	16762181	missense	probably damaging	0.98
IGL01700:Vps13a	APN	19	16744857	nonsense	probably null
IGL01767:Vps13a	APN	19	16663894	missense	probably damaging	1.00
IGL01782:Vps13a	APN	19	16754337	missense	probably damaging	0.98
IGL01808:Vps13a	APN	19	16710286	missense	probably damaging	1.00
IGL01812:Vps13a	APN	19	16715060	missense	probably benign
IGL01829:Vps13a	APN	19	16619443	missense	probably benign	0.01
IGL01893:Vps13a	APN	19	16663775	missense	probably damaging	1.00
IGL02222:Vps13a	APN	19	16682175	missense	probably benign	0.06
IGL02295:Vps13a	APN	19	16715042	splice site	probably benign
IGL02465:Vps13a	APN	19	16710941	missense	probably benign	0.11
IGL02492:Vps13a	APN	19	16647637	missense	probably damaging	1.00
IGL02581:Vps13a	APN	19	16655322	missense	probably benign	0.41
IGL02633:Vps13a	APN	19	16720408	missense	possibly damaging	0.82
IGL02641:Vps13a	APN	19	16698821	missense	probably benign	0.01
IGL02659:Vps13a	APN	19	16652699	missense	probably damaging	1.00
IGL02827:Vps13a	APN	19	16641634	missense	possibly damaging	0.91
IGL02943:Vps13a	APN	19	16663886	missense	probably damaging	1.00
IGL03057:Vps13a	APN	19	16668694	missense	probably damaging	1.00
IGL03077:Vps13a	APN	19	16710882	missense	probably benign
IGL03184:Vps13a	APN	19	16654370	missense	probably benign	0.00
eggs	UTSW	19	16701165	missense	probably damaging	1.00
excambio	UTSW	19	16745947	splice site	probably null
Faster	UTSW	19	16619485	missense	probably damaging	1.00
Ham	UTSW	19	16677969	missense	probably benign	0.08
interchange	UTSW	19	16668690	missense	probably damaging	1.00
PIT4377001:Vps13a	UTSW	19	16740901	missense	probably damaging	1.00
R0045:Vps13a	UTSW	19	16640810	nonsense	probably null
R0045:Vps13a	UTSW	19	16640810	nonsense	probably null
R0048:Vps13a	UTSW	19	16676140	missense	probably damaging	1.00
R0062:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R0062:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R0107:Vps13a	UTSW	19	16691824	missense	probably benign	0.03
R0135:Vps13a	UTSW	19	16780765	missense	probably damaging	1.00
R0138:Vps13a	UTSW	19	16660499	missense	possibly damaging	0.95
R0346:Vps13a	UTSW	19	16677969	missense	probably benign	0.08
R0359:Vps13a	UTSW	19	16641577	missense	probably damaging	0.99
R0530:Vps13a	UTSW	19	16655206	splice site	probably benign
R0541:Vps13a	UTSW	19	16704577	missense	probably benign	0.00
R0614:Vps13a	UTSW	19	16652694	missense	probably damaging	1.00
R0685:Vps13a	UTSW	19	16780741	missense	probably damaging	1.00
R0801:Vps13a	UTSW	19	16686656	splice site	probably benign
R0835:Vps13a	UTSW	19	16734882	splice site	probably null
R0848:Vps13a	UTSW	19	16698897	missense	probably damaging	1.00
R1114:Vps13a	UTSW	19	16750151	missense	probably benign	0.41
R1205:Vps13a	UTSW	19	16640541	missense	probably damaging	1.00
R1365:Vps13a	UTSW	19	16619446	missense	probably damaging	1.00
R1445:Vps13a	UTSW	19	16701238	nonsense	probably null
R1451:Vps13a	UTSW	19	16710864	missense	probably benign	0.01
R1479:Vps13a	UTSW	19	16750114	splice site	probably benign
R1533:Vps13a	UTSW	19	16701130	nonsense	probably null
R1600:Vps13a	UTSW	19	16666272	missense	probably benign	0.01
R1870:Vps13a	UTSW	19	16759952	missense	probably damaging	1.00
R1871:Vps13a	UTSW	19	16664664	missense	probably benign	0.01
R1959:Vps13a	UTSW	19	16677938	missense	possibly damaging	0.49
R1960:Vps13a	UTSW	19	16725631	missense	probably damaging	1.00
R1993:Vps13a	UTSW	19	16722458	missense	probably benign	0.07
R2257:Vps13a	UTSW	19	16682174	missense	possibly damaging	0.85
R2276:Vps13a	UTSW	19	16710426	missense	possibly damaging	0.47
R2326:Vps13a	UTSW	19	16743057	missense	possibly damaging	0.71
R2338:Vps13a	UTSW	19	16720453	missense	probably damaging	1.00
R2359:Vps13a	UTSW	19	16652679	splice site	probably benign
R2421:Vps13a	UTSW	19	16759671	missense	probably benign
R2847:Vps13a	UTSW	19	16703599	missense	probably damaging	0.98
R3081:Vps13a	UTSW	19	16664737	missense	probably benign	0.02
R3522:Vps13a	UTSW	19	16766493	splice site	probably benign
R3613:Vps13a	UTSW	19	16685402	missense	probably damaging	1.00
R3797:Vps13a	UTSW	19	16745947	splice site	probably null
R4032:Vps13a	UTSW	19	16616899	missense	probably damaging	1.00
R4111:Vps13a	UTSW	19	16640628	missense	probably damaging	1.00
R4383:Vps13a	UTSW	19	16701165	missense	probably damaging	1.00
R4504:Vps13a	UTSW	19	16695502	missense	possibly damaging	0.93
R4578:Vps13a	UTSW	19	16682110	missense	probably damaging	0.98
R4587:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4588:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4605:Vps13a	UTSW	19	16640039	missense	probably damaging	1.00
R4714:Vps13a	UTSW	19	16749856	missense	probably benign	0.01
R4756:Vps13a	UTSW	19	16655216	missense	probably benign	0.01
R4831:Vps13a	UTSW	19	16677992	missense	probably benign	0.04
R5068:Vps13a	UTSW	19	16746058	missense	probably benign	0.01
R5070:Vps13a	UTSW	19	16654484	missense	probably benign
R5082:Vps13a	UTSW	19	16744893	missense	probably damaging	1.00
R5182:Vps13a	UTSW	19	16695499	missense	possibly damaging	0.81
R5189:Vps13a	UTSW	19	16685315	missense	probably damaging	1.00
R5283:Vps13a	UTSW	19	16677970	missense	probably damaging	0.96
R5294:Vps13a	UTSW	19	16641667	missense	probably damaging	1.00
R5304:Vps13a	UTSW	19	16710387	missense	possibly damaging	0.78
R5554:Vps13a	UTSW	19	16722411	missense	probably damaging	1.00
R5592:Vps13a	UTSW	19	16725571	missense	probably damaging	1.00
R5611:Vps13a	UTSW	19	16725572	missense	probably damaging	1.00
R5665:Vps13a	UTSW	19	16668690	missense	probably damaging	1.00
R5671:Vps13a	UTSW	19	16715100	missense	probably benign	0.03
R5684:Vps13a	UTSW	19	16699045	missense	probably benign	0.00
R5767:Vps13a	UTSW	19	16664564	missense	probably damaging	1.00
R5810:Vps13a	UTSW	19	16666324	missense	probably benign	0.00
R5866:Vps13a	UTSW	19	16680023	missense	probably benign	0.04
R5886:Vps13a	UTSW	19	16664562	missense	probably benign	0.01
R5933:Vps13a	UTSW	19	16660530	missense	probably benign	0.34
R5965:Vps13a	UTSW	19	16619028	splice site	probably null
R6259:Vps13a	UTSW	19	16687170	nonsense	probably null
R6346:Vps13a	UTSW	19	16682214	missense	possibly damaging	0.94
R6459:Vps13a	UTSW	19	16664018	missense	possibly damaging	0.56
R6485:Vps13a	UTSW	19	16680050	missense	probably damaging	0.99
R6520:Vps13a	UTSW	19	16725579	missense	probably damaging	1.00
R6644:Vps13a	UTSW	19	16744919	missense	possibly damaging	0.90
R6932:Vps13a	UTSW	19	16678075	missense	probably benign	0.01
R6934:Vps13a	UTSW	19	16676194	missense	probably damaging	1.00
R6951:Vps13a	UTSW	19	16723740	missense	probably benign	0.00
R7027:Vps13a	UTSW	19	16664664	missense	probably benign	0.01
R7126:Vps13a	UTSW	19	16710879	missense	probably benign
R7206:Vps13a	UTSW	19	16754298	missense	probably damaging	1.00
R7248:Vps13a	UTSW	19	16678042	missense	probably benign	0.25
R7252:Vps13a	UTSW	19	16661064	missense	probably benign	0.00
R7255:Vps13a	UTSW	19	16654339	critical splice donor site	probably null
R7382:Vps13a	UTSW	19	16619485	missense	probably damaging	1.00
R7422:Vps13a	UTSW	19	16750173	missense	probably damaging	1.00
R7425:Vps13a	UTSW	19	16723702	missense	probably benign	0.13
R7523:Vps13a	UTSW	19	16703789	missense	probably benign
R7586:Vps13a	UTSW	19	16647598	missense	probably benign	0.08
R7587:Vps13a	UTSW	19	16703789	missense	probably benign	0.00
R7593:Vps13a	UTSW	19	16725663	missense	probably damaging	1.00
R7637:Vps13a	UTSW	19	16750149	missense	probably benign	0.02
R7763:Vps13a	UTSW	19	16746000	missense	possibly damaging	0.95
R7813:Vps13a	UTSW	19	16651456	missense	possibly damaging	0.81
R7815:Vps13a	UTSW	19	16725572	missense	probably damaging	1.00
R7861:Vps13a	UTSW	19	16655304	missense	probably damaging	1.00
R7909:Vps13a	UTSW	19	16720430	nonsense	probably null
R7939:Vps13a	UTSW	19	16740791	missense	possibly damaging	0.94
R8108:Vps13a	UTSW	19	16640787	missense	probably damaging	1.00
R8123:Vps13a	UTSW	19	16647702	missense	probably benign	0.01
R8134:Vps13a	UTSW	19	16654354	missense	possibly damaging	0.71
R8168:Vps13a	UTSW	19	16749548	missense	probably benign	0.09
R8272:Vps13a	UTSW	19	16749845	critical splice donor site	probably null
R8293:Vps13a	UTSW	19	16668605	missense	possibly damaging	0.81
R8303:Vps13a	UTSW	19	16616906	missense	probably benign	0.00
R8383:Vps13a	UTSW	19	16723705	missense	possibly damaging	0.83
R8386:Vps13a	UTSW	19	16701119	critical splice donor site	probably null
X0061:Vps13a	UTSW	19	16645868	missense	probably benign	0.40
X0066:Vps13a	UTSW	19	16742553	missense	probably benign	0.33
Z1177:Vps13a	UTSW	19	16699113	critical splice acceptor site	probably null
Z31818:Vps13a	UTSW	19	16780754	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GCTAACCTCCAAAGACATGAGAATTTC -3'
(R):5'- GACAAATTTTCCCGTTATGCCTTG -3'

Sequencing Primer
(F):5'- CATGAGAATTTCAGGAGATGGCTTC -3'
(R):5'- CGTACTGTTTTATAGTCTCCTTA -3'

Posted On

2015-04-06