Incidental Mutation 'R3874:Pdzd7'
ID 276768
Institutional Source Beutler Lab
Gene Symbol Pdzd7
Ensembl Gene ENSMUSG00000074818
Gene Name PDZ domain containing 7
Synonyms Pdzk7, EG435601
MMRRC Submission 040792-MU
Accession Numbers

Genbank: NM_001195265

Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R3874 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 45026906-45046614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45045628 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 6 (T6A)
Ref Sequence ENSEMBL: ENSMUSP00000133273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062213] [ENSMUST00000084493] [ENSMUST00000111954] [ENSMUST00000145391] [ENSMUST00000169459]
AlphaFold E9Q9W7
Predicted Effect probably benign
Transcript: ENSMUST00000062213
SMART Domains Protein: ENSMUSP00000059419
Gene: ENSMUSG00000025212

DomainStartEndE-ValueType
Pfam:Mtc 15 321 1.8e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084493
SMART Domains Protein: ENSMUSP00000081537
Gene: ENSMUSG00000025212

DomainStartEndE-ValueType
Pfam:Mtc 15 230 2.5e-106 PFAM
Pfam:Mtc 225 280 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111954
SMART Domains Protein: ENSMUSP00000107585
Gene: ENSMUSG00000025212

DomainStartEndE-ValueType
Pfam:Mtc 15 114 1.4e-48 PFAM
Pfam:Mtc 110 288 2.3e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145391
AA Change: T6A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119002
Gene: ENSMUSG00000074818
AA Change: T6A

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169459
AA Change: T6A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133273
Gene: ENSMUSG00000074818
AA Change: T6A

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary protein homologous to proteins which are mutated in Usher syndrome patients, and mutations and translocations involving this gene have been associated with two types of Usher syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit profound deafness due to abnormal outer cochlear hair cell morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Dsg1c A G 18: 20,277,052 I526V probably benign Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Pdzd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Pdzd7 APN 19 45040258 missense probably damaging 1.00
IGL02729:Pdzd7 APN 19 45045643 start codon destroyed probably null 0.89
F6893:Pdzd7 UTSW 19 45036734 missense probably damaging 0.98
R0211:Pdzd7 UTSW 19 45033667 missense possibly damaging 0.72
R0211:Pdzd7 UTSW 19 45033667 missense possibly damaging 0.72
R0295:Pdzd7 UTSW 19 45037072 missense probably benign 0.01
R0523:Pdzd7 UTSW 19 45036090 missense probably benign 0.01
R0645:Pdzd7 UTSW 19 45045475 missense possibly damaging 0.95
R0731:Pdzd7 UTSW 19 45029305 missense probably damaging 1.00
R1265:Pdzd7 UTSW 19 45040685 missense possibly damaging 0.64
R1711:Pdzd7 UTSW 19 45045511 missense possibly damaging 0.68
R1789:Pdzd7 UTSW 19 45039228 missense probably damaging 1.00
R1817:Pdzd7 UTSW 19 45036176 missense probably damaging 0.98
R2162:Pdzd7 UTSW 19 45036055 critical splice donor site probably null
R2851:Pdzd7 UTSW 19 45027674 missense probably benign
R2852:Pdzd7 UTSW 19 45027674 missense probably benign
R2939:Pdzd7 UTSW 19 45045423 missense possibly damaging 0.89
R3832:Pdzd7 UTSW 19 45040254 missense probably damaging 1.00
R4416:Pdzd7 UTSW 19 45040580 missense probably damaging 1.00
R4668:Pdzd7 UTSW 19 45045687 start gained probably benign
R5133:Pdzd7 UTSW 19 45028429 missense possibly damaging 0.51
R5327:Pdzd7 UTSW 19 45028777 missense probably benign
R5458:Pdzd7 UTSW 19 45027791 missense probably benign
R5480:Pdzd7 UTSW 19 45039285 missense possibly damaging 0.65
R5644:Pdzd7 UTSW 19 45040180 missense probably benign 0.16
R5799:Pdzd7 UTSW 19 45036989 missense probably benign 0.06
R5812:Pdzd7 UTSW 19 45036871 missense probably damaging 1.00
R5873:Pdzd7 UTSW 19 45027949 missense probably damaging 1.00
R6669:Pdzd7 UTSW 19 45036751 missense possibly damaging 0.94
R6750:Pdzd7 UTSW 19 45027748 missense probably benign
R7128:Pdzd7 UTSW 19 45027949 missense probably damaging 0.99
R7183:Pdzd7 UTSW 19 45037114 missense probably benign
R7378:Pdzd7 UTSW 19 45045606 missense probably damaging 0.99
R7395:Pdzd7 UTSW 19 45037011 missense probably damaging 1.00
R7426:Pdzd7 UTSW 19 45033647 missense possibly damaging 0.68
R7790:Pdzd7 UTSW 19 45045523 nonsense probably null
R7792:Pdzd7 UTSW 19 45040218 missense possibly damaging 0.54
R7829:Pdzd7 UTSW 19 45039239 missense probably benign 0.00
R7883:Pdzd7 UTSW 19 45030240 missense probably damaging 1.00
R7969:Pdzd7 UTSW 19 45036225 missense probably benign 0.01
R8387:Pdzd7 UTSW 19 45030051 missense probably damaging 1.00
R8720:Pdzd7 UTSW 19 45036228 missense probably benign 0.27
R8830:Pdzd7 UTSW 19 45033073 missense probably damaging 1.00
R9282:Pdzd7 UTSW 19 45040183 missense probably damaging 0.96
R9417:Pdzd7 UTSW 19 45045583 missense not run
Predicted Primers PCR Primer
(F):5'- AGTTGATGAGGATGACCCGG -3'
(R):5'- AGATCCCTCTCTTCCAAGTGG -3'

Sequencing Primer
(F):5'- AGGATGACCCGGCCCATG -3'
(R):5'- ACTTTCCAGAACAGGGTGGC -3'
Posted On 2015-04-06