Incidental Mutation 'R3875:Mlph'
ID276771
Institutional Source Beutler Lab
Gene Symbol Mlph
Ensembl Gene ENSMUSG00000026303
Gene Namemelanophilin
Synonymsl1Rk3, l(1)-3Rk, D1Wsu84e, Slac-2a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R3875 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location90915085-90951142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90928122 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 57 (C57R)
Ref Sequence ENSEMBL: ENSMUSP00000123314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027528] [ENSMUST00000125149]
Predicted Effect probably damaging
Transcript: ENSMUST00000027528
AA Change: C84R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027528
Gene: ENSMUSG00000026303
AA Change: C84R

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 2e-51 PFAM
low complexity region 147 160 N/A INTRINSIC
PDB:4KP3|F 170 208 1e-18 PDB
low complexity region 379 406 N/A INTRINSIC
Pfam:Rab_eff_C 437 501 1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125149
AA Change: C57R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123314
Gene: ENSMUSG00000026303
AA Change: C57R

DomainStartEndE-ValueType
Pfam:FYVE_2 10 98 1.3e-36 PFAM
Meta Mutation Damage Score 0.9688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the exophilin subfamily of Rab effector proteins. The protein forms a ternary complex with the small Ras-related GTPase Rab27A in its GTP-bound form and the motor protein myosin Va. A similar protein complex in mouse functions to tether pigment-producing organelles called melanosomes to the actin cytoskeleton in melanocytes, and is required for visible pigmentation in the hair and skin. A mutation in this gene results in Griscelli syndrome type 3, which is characterized by a silver-gray hair color and abnormal pigment distribution in the hair shaft. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous targeted null mutants affect viability and body size, and result in abnormal lungs, kidneys, immune system, hematopoiesis, myelopoiesis, and anomalies in cerebellar foliation and neuronal cell layer development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T C 2: 152,434,080 S72P probably benign Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Adgrg2 A G X: 160,478,996 S337G probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cacna1g G A 11: 94,437,923 T1033I probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cpne1 G A 2: 156,076,282 H352Y probably damaging Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dhodh T C 8: 109,594,960 D310G probably null Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Drd5 T G 5: 38,319,814 V50G possibly damaging Het
Dst C A 1: 34,171,247 H934Q probably damaging Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Fbxo43 A T 15: 36,162,103 F319L probably benign Het
Flii T C 11: 60,720,492 S418G probably benign Het
Glyctk T A 9: 106,157,621 Y82F probably damaging Het
Gm11353 G T 13: 26,492,668 noncoding transcript Het
Gm6505 T A 3: 28,765,137 noncoding transcript Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Gpr151 A G 18: 42,578,596 V339A probably benign Het
H2-T22 T C 17: 36,040,303 I296V probably benign Het
Igfn1 T C 1: 135,954,614 N2831S probably damaging Het
Igkv13-85 A G 6: 68,930,500 V39A probably damaging Het
Irx5 A G 8: 92,360,165 T242A probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Mcoln1 A G 8: 3,508,355 D203G probably benign Het
Myh13 C A 11: 67,358,194 H1275Q probably benign Het
Nbeal1 T A 1: 60,194,599 probably benign Het
Orc5 T A 5: 22,537,566 M115L probably benign Het
Pcdha6 T A 18: 36,968,066 I104N probably damaging Het
Plcb4 T C 2: 136,002,632 S157P probably damaging Het
Polq A G 16: 37,074,027 D1787G probably damaging Het
Prkar2b T G 12: 31,965,123 I142L probably benign Het
Ptprq A G 10: 107,685,104 S736P possibly damaging Het
Qrich2 A T 11: 116,445,651 V2046D probably damaging Het
Rad21 A T 15: 51,969,965 F373I probably damaging Het
Rcvrn A G 11: 67,700,054 I155V probably benign Het
Rsrc2 C T 5: 123,736,628 probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Ssc5d A T 7: 4,927,262 D114V probably damaging Het
St6gal2 C A 17: 55,482,697 P244Q probably benign Het
Tarbp1 A G 8: 126,438,799 probably benign Het
Tmem221 T C 8: 71,555,755 probably null Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Trim32 A T 4: 65,613,466 I87F possibly damaging Het
Tti2 A G 8: 31,151,147 K100E probably benign Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vps13d A G 4: 145,190,544 Y17H probably damaging Het
Zfp106 T C 2: 120,534,613 K438E probably benign Het
Zfp60 T C 7: 27,749,581 I558T probably damaging Het
Zzef1 A C 11: 72,889,040 I1880L probably benign Het
Other mutations in Mlph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mlph APN 1 90939390 missense probably damaging 1.00
IGL01779:Mlph APN 1 90942950 missense probably benign
IGL01952:Mlph APN 1 90933471 missense probably benign 0.00
beau UTSW 1 90928122 missense probably damaging 1.00
Golem UTSW 1 unclassified
koala UTSW 1 90933301 unclassified probably benign
R0652:Mlph UTSW 1 90942908 missense possibly damaging 0.89
R1374:Mlph UTSW 1 90941703 missense probably damaging 1.00
R1643:Mlph UTSW 1 90941734 missense probably damaging 1.00
R1853:Mlph UTSW 1 90945667 nonsense probably null
R2395:Mlph UTSW 1 90933506 missense probably benign 0.06
R4632:Mlph UTSW 1 90939386 missense probably damaging 0.99
R4720:Mlph UTSW 1 90941697 missense probably damaging 1.00
R4963:Mlph UTSW 1 90939390 missense probably damaging 1.00
R5588:Mlph UTSW 1 90931599 missense possibly damaging 0.91
R5901:Mlph UTSW 1 90939814 missense probably damaging 1.00
R6063:Mlph UTSW 1 90928160 missense probably damaging 1.00
R6912:Mlph UTSW 1 90945620 missense probably damaging 0.98
R7019:Mlph UTSW 1 90941706 missense probably damaging 1.00
R7336:Mlph UTSW 1 90921983 splice site probably null
R7491:Mlph UTSW 1 90939378 missense possibly damaging 0.87
X0013:Mlph UTSW 1 90928154 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCACTGGTCGGTTGTAGAAAC -3'
(R):5'- CCAGAGAACCGATCTTCACG -3'

Sequencing Primer
(F):5'- ATTTTTTCCCAAGGGGGC -3'
(R):5'- GAGAACCGATCTTCACGACCCTG -3'
Posted On2015-04-06