Incidental Mutation 'R3875:Zfp106'
ID276773
Institutional Source Beutler Lab
Gene Symbol Zfp106
Ensembl Gene ENSMUSG00000027288
Gene Namezinc finger protein 106
SynonymsCd-1, H3a, Sh3bp3, sirm
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3875 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120506820-120563843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120534613 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 438 (K438E)
Ref Sequence ENSEMBL: ENSMUSP00000128995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]
Predicted Effect probably benign
Transcript: ENSMUST00000055241
AA Change: K461E

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: K461E

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
ZnF_C2H2 43 67 7.18e1 SMART
low complexity region 75 92 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 199 212 N/A INTRINSIC
low complexity region 466 480 N/A INTRINSIC
coiled coil region 800 823 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
low complexity region 1312 1321 N/A INTRINSIC
low complexity region 1361 1373 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
WD40 1525 1562 9.24e-4 SMART
WD40 1565 1607 1.83e-7 SMART
PQQ 1587 1618 3.42e2 SMART
WD40 1651 1691 3.45e-1 SMART
PQQ 1671 1702 9.14e1 SMART
WD40 1694 1731 2.12e-3 SMART
PQQ 1711 1742 6.42e0 SMART
WD40 1734 1771 6e-3 SMART
PQQ 1751 1782 5.7e2 SMART
WD40 1774 1811 3.58e-1 SMART
ZnF_C2H2 1818 1843 5.34e-1 SMART
ZnF_C2H2 1851 1879 1.31e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135625
SMART Domains Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147353
Predicted Effect probably benign
Transcript: ENSMUST00000163384
Predicted Effect probably benign
Transcript: ENSMUST00000167241
SMART Domains Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 4 28 1.51e0 SMART
low complexity region 74 85 N/A INTRINSIC
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171215
AA Change: K438E

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: K438E

DomainStartEndE-ValueType
ZnF_C2H2 20 44 7.18e1 SMART
low complexity region 52 69 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 176 189 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
coiled coil region 777 800 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1289 1298 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1366 1386 N/A INTRINSIC
WD40 1502 1539 9.24e-4 SMART
WD40 1542 1584 1.83e-7 SMART
PQQ 1564 1595 3.42e2 SMART
WD40 1628 1668 3.45e-1 SMART
PQQ 1648 1679 9.14e1 SMART
WD40 1671 1708 2.12e-3 SMART
PQQ 1688 1719 6.42e0 SMART
WD40 1711 1748 6e-3 SMART
PQQ 1728 1759 5.7e2 SMART
WD40 1751 1788 3.58e-1 SMART
ZnF_C2H2 1795 1820 5.34e-1 SMART
ZnF_C2H2 1828 1856 1.31e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181963
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T C 2: 152,434,080 S72P probably benign Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Adgrg2 A G X: 160,478,996 S337G probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cacna1g G A 11: 94,437,923 T1033I probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cpne1 G A 2: 156,076,282 H352Y probably damaging Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dhodh T C 8: 109,594,960 D310G probably null Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Drd5 T G 5: 38,319,814 V50G possibly damaging Het
Dst C A 1: 34,171,247 H934Q probably damaging Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Fbxo43 A T 15: 36,162,103 F319L probably benign Het
Flii T C 11: 60,720,492 S418G probably benign Het
Glyctk T A 9: 106,157,621 Y82F probably damaging Het
Gm11353 G T 13: 26,492,668 noncoding transcript Het
Gm6505 T A 3: 28,765,137 noncoding transcript Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Gpr151 A G 18: 42,578,596 V339A probably benign Het
H2-T22 T C 17: 36,040,303 I296V probably benign Het
Igfn1 T C 1: 135,954,614 N2831S probably damaging Het
Igkv13-85 A G 6: 68,930,500 V39A probably damaging Het
Irx5 A G 8: 92,360,165 T242A probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Mcoln1 A G 8: 3,508,355 D203G probably benign Het
Mlph T C 1: 90,928,122 C57R probably damaging Het
Myh13 C A 11: 67,358,194 H1275Q probably benign Het
Nbeal1 T A 1: 60,194,599 probably benign Het
Orc5 T A 5: 22,537,566 M115L probably benign Het
Pcdha6 T A 18: 36,968,066 I104N probably damaging Het
Plcb4 T C 2: 136,002,632 S157P probably damaging Het
Polq A G 16: 37,074,027 D1787G probably damaging Het
Prkar2b T G 12: 31,965,123 I142L probably benign Het
Ptprq A G 10: 107,685,104 S736P possibly damaging Het
Qrich2 A T 11: 116,445,651 V2046D probably damaging Het
Rad21 A T 15: 51,969,965 F373I probably damaging Het
Rcvrn A G 11: 67,700,054 I155V probably benign Het
Rsrc2 C T 5: 123,736,628 probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Ssc5d A T 7: 4,927,262 D114V probably damaging Het
St6gal2 C A 17: 55,482,697 P244Q probably benign Het
Tarbp1 A G 8: 126,438,799 probably benign Het
Tmem221 T C 8: 71,555,755 probably null Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Trim32 A T 4: 65,613,466 I87F possibly damaging Het
Tti2 A G 8: 31,151,147 K100E probably benign Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vps13d A G 4: 145,190,544 Y17H probably damaging Het
Zfp60 T C 7: 27,749,581 I558T probably damaging Het
Zzef1 A C 11: 72,889,040 I1880L probably benign Het
Other mutations in Zfp106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Zfp106 APN 2 120539497 missense probably benign 0.45
IGL00816:Zfp106 APN 2 120526848 missense probably benign 0.02
IGL00822:Zfp106 APN 2 120514160 missense probably damaging 1.00
IGL00848:Zfp106 APN 2 120512727 missense probably damaging 1.00
IGL01293:Zfp106 APN 2 120535035 missense possibly damaging 0.92
IGL01323:Zfp106 APN 2 120524464 missense possibly damaging 0.74
IGL01662:Zfp106 APN 2 120523553 missense probably benign 0.17
IGL01683:Zfp106 APN 2 120524555 missense probably benign 0.00
IGL01809:Zfp106 APN 2 120533671 missense probably damaging 1.00
IGL01958:Zfp106 APN 2 120534807 missense probably benign 0.26
IGL01960:Zfp106 APN 2 120524043 missense probably damaging 0.99
IGL01960:Zfp106 APN 2 120539322 missense probably benign 0.08
IGL02168:Zfp106 APN 2 120534231 missense possibly damaging 0.90
IGL02623:Zfp106 APN 2 120545914 splice site probably null
IGL02798:Zfp106 APN 2 120510510 missense probably damaging 1.00
IGL02828:Zfp106 APN 2 120531697 missense possibly damaging 0.86
IGL03022:Zfp106 APN 2 120528639 splice site probably benign
IGL03308:Zfp106 APN 2 120524024 missense probably benign 0.00
IGL03324:Zfp106 APN 2 120535387 missense probably benign 0.01
lepton UTSW 2 120532104 missense probably damaging 0.98
proton UTSW 2 120510534 missense probably damaging 1.00
quark UTSW 2 120535060 nonsense probably null
string UTSW 2 120533594 missense probably damaging 0.96
theory UTSW 2 120533677 nonsense probably null
R0040:Zfp106 UTSW 2 120531613 missense probably damaging 1.00
R0040:Zfp106 UTSW 2 120531613 missense probably damaging 1.00
R0135:Zfp106 UTSW 2 120520487 missense probably damaging 0.99
R0180:Zfp106 UTSW 2 120533875 missense probably damaging 0.96
R0387:Zfp106 UTSW 2 120528472 splice site probably null
R0558:Zfp106 UTSW 2 120532196 missense probably damaging 1.00
R0680:Zfp106 UTSW 2 120527016 missense probably damaging 1.00
R0729:Zfp106 UTSW 2 120555248 missense probably damaging 0.99
R0828:Zfp106 UTSW 2 120535603 missense probably benign 0.00
R1124:Zfp106 UTSW 2 120534714 missense probably benign 0.00
R1147:Zfp106 UTSW 2 120520536 missense probably damaging 1.00
R1147:Zfp106 UTSW 2 120520536 missense probably damaging 1.00
R1226:Zfp106 UTSW 2 120524079 missense probably damaging 1.00
R1239:Zfp106 UTSW 2 120533594 missense probably damaging 0.96
R1634:Zfp106 UTSW 2 120533677 nonsense probably null
R1754:Zfp106 UTSW 2 120533763 missense probably damaging 0.96
R1754:Zfp106 UTSW 2 120533764 missense probably damaging 0.98
R1755:Zfp106 UTSW 2 120535175 missense probably damaging 1.00
R1763:Zfp106 UTSW 2 120520428 missense probably benign 0.03
R1875:Zfp106 UTSW 2 120513615 critical splice donor site probably null
R1903:Zfp106 UTSW 2 120526848 missense probably benign 0.02
R1932:Zfp106 UTSW 2 120531681 missense possibly damaging 0.80
R2070:Zfp106 UTSW 2 120523529 missense probably benign 0.11
R2301:Zfp106 UTSW 2 120535650 missense probably benign 0.04
R3429:Zfp106 UTSW 2 120527063 missense probably benign 0.00
R3720:Zfp106 UTSW 2 120534599 missense probably benign 0.01
R3881:Zfp106 UTSW 2 120532149 missense probably benign 0.01
R3921:Zfp106 UTSW 2 120533616 missense probably damaging 1.00
R3923:Zfp106 UTSW 2 120534856 missense probably damaging 0.99
R4087:Zfp106 UTSW 2 120526899 unclassified probably null
R4678:Zfp106 UTSW 2 120533740 missense probably damaging 1.00
R4965:Zfp106 UTSW 2 120533919 missense probably damaging 0.98
R5011:Zfp106 UTSW 2 120510534 missense probably damaging 1.00
R5013:Zfp106 UTSW 2 120510534 missense probably damaging 1.00
R5151:Zfp106 UTSW 2 120534727 missense probably benign 0.01
R5227:Zfp106 UTSW 2 120523968 missense probably benign 0.11
R5328:Zfp106 UTSW 2 120520417 missense possibly damaging 0.73
R5403:Zfp106 UTSW 2 120534781 missense probably benign 0.02
R5624:Zfp106 UTSW 2 120531957 missense probably damaging 0.99
R5686:Zfp106 UTSW 2 120533507 unclassified probably null
R5691:Zfp106 UTSW 2 120524471 missense probably damaging 0.99
R5852:Zfp106 UTSW 2 120516006 missense probably damaging 1.00
R6032:Zfp106 UTSW 2 120535393 missense probably benign 0.00
R6032:Zfp106 UTSW 2 120535393 missense probably benign 0.00
R6298:Zfp106 UTSW 2 120522704 missense probably damaging 1.00
R6409:Zfp106 UTSW 2 120532104 missense probably damaging 0.98
R6505:Zfp106 UTSW 2 120534502 missense probably damaging 0.99
R6598:Zfp106 UTSW 2 120535060 nonsense probably null
R6765:Zfp106 UTSW 2 120539454 missense probably damaging 0.96
R7013:Zfp106 UTSW 2 120531632 missense probably damaging 0.99
R7453:Zfp106 UTSW 2 120510527 missense probably damaging 1.00
R7453:Zfp106 UTSW 2 120545919 splice site probably null
R7643:Zfp106 UTSW 2 120512734 missense probably benign 0.01
R7829:Zfp106 UTSW 2 120524057 missense possibly damaging 0.94
R7897:Zfp106 UTSW 2 120535615 nonsense probably null
R7909:Zfp106 UTSW 2 120514219 missense probably damaging 1.00
R7980:Zfp106 UTSW 2 120535615 nonsense probably null
R7990:Zfp106 UTSW 2 120514219 missense probably damaging 1.00
R8054:Zfp106 UTSW 2 120524519 missense possibly damaging 0.93
RF008:Zfp106 UTSW 2 120524545 small deletion probably benign
RF025:Zfp106 UTSW 2 120524545 small deletion probably benign
X0025:Zfp106 UTSW 2 120534816 missense probably benign
Z1088:Zfp106 UTSW 2 120530490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAAGAACCATGGCTACCTTC -3'
(R):5'- TTGGCAGCAAGTCAGACACAC -3'

Sequencing Primer
(F):5'- GAACCATGGCTACCTTCTAAAGTAG -3'
(R):5'- GTCAGACACACTAGAGAAGCCTCTC -3'
Posted On2015-04-06