Incidental Mutation 'R3875:Trim32'
ID276779
Institutional Source Beutler Lab
Gene Symbol Trim32
Ensembl Gene ENSMUSG00000051675
Gene Nametripartite motif-containing 32
Synonyms1810045E12Rik, Zfp117, BBS11, 3f3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R3875 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location65604986-65616238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65613466 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 87 (I87F)
Ref Sequence ENSEMBL: ENSMUSP00000119579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050850] [ENSMUST00000068214] [ENSMUST00000084496] [ENSMUST00000107366] [ENSMUST00000155978] [ENSMUST00000156922]
Predicted Effect probably benign
Transcript: ENSMUST00000050850
AA Change: I87F

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000062277
Gene: ENSMUSG00000051675
AA Change: I87F

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
low complexity region 253 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Pfam:NHL 471 498 6.9e-7 PFAM
Pfam:NHL 618 645 4.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068214
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084496
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107366
AA Change: I87F

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102989
Gene: ENSMUSG00000051675
AA Change: I87F

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
low complexity region 253 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Pfam:NHL 373 400 3.6e-7 PFAM
Pfam:NHL 471 498 2.7e-7 PFAM
Pfam:NHL 618 645 2.5e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155978
AA Change: I87F

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119579
Gene: ENSMUSG00000051675
AA Change: I87F

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
Blast:BBOX 96 136 3e-22 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000156922
AA Change: I87F

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121949
Gene: ENSMUSG00000051675
AA Change: I87F

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
Meta Mutation Damage Score 0.2005 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein has also been localized to the nucleus, where it interacts with the activation domain of the HIV-1 Tat protein. The Tat protein activates transcription of HIV-1 genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit mild myopathy with sarcotubular myopathy, decreased fertility, and decreased axon diameter. Mice homozygous for a knock-out allele exhibit impaired adult muscle regeneration and myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T C 2: 152,434,080 S72P probably benign Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Adgrg2 A G X: 160,478,996 S337G probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cacna1g G A 11: 94,437,923 T1033I probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cpne1 G A 2: 156,076,282 H352Y probably damaging Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dhodh T C 8: 109,594,960 D310G probably null Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Drd5 T G 5: 38,319,814 V50G possibly damaging Het
Dst C A 1: 34,171,247 H934Q probably damaging Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Fbxo43 A T 15: 36,162,103 F319L probably benign Het
Flii T C 11: 60,720,492 S418G probably benign Het
Glyctk T A 9: 106,157,621 Y82F probably damaging Het
Gm11353 G T 13: 26,492,668 noncoding transcript Het
Gm6505 T A 3: 28,765,137 noncoding transcript Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Gpr151 A G 18: 42,578,596 V339A probably benign Het
H2-T22 T C 17: 36,040,303 I296V probably benign Het
Igfn1 T C 1: 135,954,614 N2831S probably damaging Het
Igkv13-85 A G 6: 68,930,500 V39A probably damaging Het
Irx5 A G 8: 92,360,165 T242A probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Mcoln1 A G 8: 3,508,355 D203G probably benign Het
Mlph T C 1: 90,928,122 C57R probably damaging Het
Myh13 C A 11: 67,358,194 H1275Q probably benign Het
Nbeal1 T A 1: 60,194,599 probably benign Het
Orc5 T A 5: 22,537,566 M115L probably benign Het
Pcdha6 T A 18: 36,968,066 I104N probably damaging Het
Plcb4 T C 2: 136,002,632 S157P probably damaging Het
Polq A G 16: 37,074,027 D1787G probably damaging Het
Prkar2b T G 12: 31,965,123 I142L probably benign Het
Ptprq A G 10: 107,685,104 S736P possibly damaging Het
Qrich2 A T 11: 116,445,651 V2046D probably damaging Het
Rad21 A T 15: 51,969,965 F373I probably damaging Het
Rcvrn A G 11: 67,700,054 I155V probably benign Het
Rsrc2 C T 5: 123,736,628 probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Ssc5d A T 7: 4,927,262 D114V probably damaging Het
St6gal2 C A 17: 55,482,697 P244Q probably benign Het
Tarbp1 A G 8: 126,438,799 probably benign Het
Tmem221 T C 8: 71,555,755 probably null Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Tti2 A G 8: 31,151,147 K100E probably benign Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vps13d A G 4: 145,190,544 Y17H probably damaging Het
Zfp106 T C 2: 120,534,613 K438E probably benign Het
Zfp60 T C 7: 27,749,581 I558T probably damaging Het
Zzef1 A C 11: 72,889,040 I1880L probably benign Het
Other mutations in Trim32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Trim32 APN 4 65614499 missense probably damaging 1.00
IGL02534:Trim32 APN 4 65614669 missense possibly damaging 0.72
R0302:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0356:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0358:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0497:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0544:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0547:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0611:Trim32 UTSW 4 65613656 missense possibly damaging 0.71
R1183:Trim32 UTSW 4 65614391 missense probably benign 0.00
R1523:Trim32 UTSW 4 65614004 missense probably benign 0.04
R1784:Trim32 UTSW 4 65614397 missense probably damaging 0.96
R1939:Trim32 UTSW 4 65614066 missense probably benign
R2069:Trim32 UTSW 4 65614776 nonsense probably null
R2869:Trim32 UTSW 4 65614457 missense probably damaging 1.00
R2869:Trim32 UTSW 4 65614457 missense probably damaging 1.00
R5464:Trim32 UTSW 4 65614388 missense probably damaging 1.00
R6246:Trim32 UTSW 4 65614564 missense probably damaging 1.00
R6610:Trim32 UTSW 4 65615071 missense probably damaging 1.00
Z1177:Trim32 UTSW 4 65614825 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGGAGTCCTTCACTGAAGAG -3'
(R):5'- TTAGACGAGTCAACTTCTCCCC -3'

Sequencing Primer
(F):5'- GCAGCTGCGACCCAAGC -3'
(R):5'- TCCCCGAAGTCCCTCCG -3'
Posted On2015-04-06