Incidental Mutation 'R3875:Mcoln1'
ID276790
Institutional Source Beutler Lab
Gene Symbol Mcoln1
Ensembl Gene ENSMUSG00000004567
Gene Namemucolipin 1
SynonymsTRPML1, mucolipidin, 2210015I05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3875 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3500457-3515232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3508355 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 203 (D203G)
Ref Sequence ENSEMBL: ENSMUSP00000004683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004683] [ENSMUST00000160338] [ENSMUST00000208306] [ENSMUST00000208359]
Predicted Effect probably benign
Transcript: ENSMUST00000004683
AA Change: D203G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004683
Gene: ENSMUSG00000004567
AA Change: D203G

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:PKD_channel 378 524 2.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159808
Predicted Effect probably benign
Transcript: ENSMUST00000160338
SMART Domains Protein: ENSMUSP00000123717
Gene: ENSMUSG00000004567

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161705
Predicted Effect probably benign
Transcript: ENSMUST00000161842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162797
Predicted Effect probably benign
Transcript: ENSMUST00000208306
Predicted Effect probably benign
Transcript: ENSMUST00000208359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208739
Predicted Effect probably benign
Transcript: ENSMUST00000208943
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death around 8 months of age preceeded by weight loss, weakness, lethargy, bladder and stomach distension, and retinal degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T C 2: 152,434,080 S72P probably benign Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Adgrg2 A G X: 160,478,996 S337G probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cacna1g G A 11: 94,437,923 T1033I probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cpne1 G A 2: 156,076,282 H352Y probably damaging Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dhodh T C 8: 109,594,960 D310G probably null Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Drd5 T G 5: 38,319,814 V50G possibly damaging Het
Dst C A 1: 34,171,247 H934Q probably damaging Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Fbxo43 A T 15: 36,162,103 F319L probably benign Het
Flii T C 11: 60,720,492 S418G probably benign Het
Glyctk T A 9: 106,157,621 Y82F probably damaging Het
Gm11353 G T 13: 26,492,668 noncoding transcript Het
Gm6505 T A 3: 28,765,137 noncoding transcript Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Gpr151 A G 18: 42,578,596 V339A probably benign Het
H2-T22 T C 17: 36,040,303 I296V probably benign Het
Igfn1 T C 1: 135,954,614 N2831S probably damaging Het
Igkv13-85 A G 6: 68,930,500 V39A probably damaging Het
Irx5 A G 8: 92,360,165 T242A probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Mlph T C 1: 90,928,122 C57R probably damaging Het
Myh13 C A 11: 67,358,194 H1275Q probably benign Het
Nbeal1 T A 1: 60,194,599 probably benign Het
Orc5 T A 5: 22,537,566 M115L probably benign Het
Pcdha6 T A 18: 36,968,066 I104N probably damaging Het
Plcb4 T C 2: 136,002,632 S157P probably damaging Het
Polq A G 16: 37,074,027 D1787G probably damaging Het
Prkar2b T G 12: 31,965,123 I142L probably benign Het
Ptprq A G 10: 107,685,104 S736P possibly damaging Het
Qrich2 A T 11: 116,445,651 V2046D probably damaging Het
Rad21 A T 15: 51,969,965 F373I probably damaging Het
Rcvrn A G 11: 67,700,054 I155V probably benign Het
Rsrc2 C T 5: 123,736,628 probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Ssc5d A T 7: 4,927,262 D114V probably damaging Het
St6gal2 C A 17: 55,482,697 P244Q probably benign Het
Tarbp1 A G 8: 126,438,799 probably benign Het
Tmem221 T C 8: 71,555,755 probably null Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Trim32 A T 4: 65,613,466 I87F possibly damaging Het
Tti2 A G 8: 31,151,147 K100E probably benign Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vps13d A G 4: 145,190,544 Y17H probably damaging Het
Zfp106 T C 2: 120,534,613 K438E probably benign Het
Zfp60 T C 7: 27,749,581 I558T probably damaging Het
Zzef1 A C 11: 72,889,040 I1880L probably benign Het
Other mutations in Mcoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Mcoln1 APN 8 3507558 missense possibly damaging 0.89
IGL01621:Mcoln1 APN 8 3510910 missense probably damaging 1.00
IGL02147:Mcoln1 APN 8 3508379 missense probably benign
IGL02156:Mcoln1 APN 8 3512657 nonsense probably null
R0616:Mcoln1 UTSW 8 3515025 missense probably benign 0.00
R1498:Mcoln1 UTSW 8 3512861 missense probably damaging 1.00
R2102:Mcoln1 UTSW 8 3511731 missense probably damaging 1.00
R2155:Mcoln1 UTSW 8 3511787 missense probably damaging 1.00
R2178:Mcoln1 UTSW 8 3508766 missense probably damaging 1.00
R2218:Mcoln1 UTSW 8 3505813 missense possibly damaging 0.50
R3828:Mcoln1 UTSW 8 3500601 missense possibly damaging 0.93
R3971:Mcoln1 UTSW 8 3507408 missense probably benign 0.01
R4621:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4622:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4659:Mcoln1 UTSW 8 3510840 missense probably damaging 1.00
R4873:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4875:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4914:Mcoln1 UTSW 8 3507483 nonsense probably null
R5114:Mcoln1 UTSW 8 3510697 unclassified probably benign
R5586:Mcoln1 UTSW 8 3510389 missense probably damaging 1.00
R5876:Mcoln1 UTSW 8 3510910 missense probably damaging 1.00
R5946:Mcoln1 UTSW 8 3508701 missense probably damaging 1.00
R6520:Mcoln1 UTSW 8 3505855 missense probably damaging 1.00
R7449:Mcoln1 UTSW 8 3507285 missense probably damaging 0.98
R7712:Mcoln1 UTSW 8 3505873 missense probably damaging 0.99
R7904:Mcoln1 UTSW 8 3508356 missense probably benign
R7987:Mcoln1 UTSW 8 3508356 missense probably benign
R8058:Mcoln1 UTSW 8 3508378 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTAGCTCCAGTGGACTC -3'
(R):5'- GAAAGTGGCCTCAGCTCCAATG -3'

Sequencing Primer
(F):5'- CAGATTATAGACTTGATCCCTGGTGC -3'
(R):5'- AATGTTTGGACTCTGGCCAC -3'
Posted On2015-04-06