Incidental Mutation 'R3875:Tmem221'
ID276792
Institutional Source Beutler Lab
Gene Symbol Tmem221
Ensembl Gene ENSMUSG00000043664
Gene Nametransmembrane protein 221
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R3875 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71554238-71558871 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 71555755 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048243] [ENSMUST00000052072] [ENSMUST00000163659]
Predicted Effect probably benign
Transcript: ENSMUST00000048243
SMART Domains Protein: ENSMUSP00000039294
Gene: ENSMUSG00000034829

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 32 132 2.8e-24 PFAM
low complexity region 187 202 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000052072
SMART Domains Protein: ENSMUSP00000058317
Gene: ENSMUSG00000043664

DomainStartEndE-ValueType
Pfam:Jiraiya 10 186 1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163659
SMART Domains Protein: ENSMUSP00000127094
Gene: ENSMUSG00000034829

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 32 132 1.5e-22 PFAM
low complexity region 187 202 N/A INTRINSIC
Meta Mutation Damage Score 0.1034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T C 2: 152,434,080 S72P probably benign Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Adgrg2 A G X: 160,478,996 S337G probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cacna1g G A 11: 94,437,923 T1033I probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cpne1 G A 2: 156,076,282 H352Y probably damaging Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dhodh T C 8: 109,594,960 D310G probably null Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Drd5 T G 5: 38,319,814 V50G possibly damaging Het
Dst C A 1: 34,171,247 H934Q probably damaging Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Fbxo43 A T 15: 36,162,103 F319L probably benign Het
Flii T C 11: 60,720,492 S418G probably benign Het
Glyctk T A 9: 106,157,621 Y82F probably damaging Het
Gm11353 G T 13: 26,492,668 noncoding transcript Het
Gm6505 T A 3: 28,765,137 noncoding transcript Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Gpr151 A G 18: 42,578,596 V339A probably benign Het
H2-T22 T C 17: 36,040,303 I296V probably benign Het
Igfn1 T C 1: 135,954,614 N2831S probably damaging Het
Igkv13-85 A G 6: 68,930,500 V39A probably damaging Het
Irx5 A G 8: 92,360,165 T242A probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Mcoln1 A G 8: 3,508,355 D203G probably benign Het
Mlph T C 1: 90,928,122 C57R probably damaging Het
Myh13 C A 11: 67,358,194 H1275Q probably benign Het
Nbeal1 T A 1: 60,194,599 probably benign Het
Orc5 T A 5: 22,537,566 M115L probably benign Het
Pcdha6 T A 18: 36,968,066 I104N probably damaging Het
Plcb4 T C 2: 136,002,632 S157P probably damaging Het
Polq A G 16: 37,074,027 D1787G probably damaging Het
Prkar2b T G 12: 31,965,123 I142L probably benign Het
Ptprq A G 10: 107,685,104 S736P possibly damaging Het
Qrich2 A T 11: 116,445,651 V2046D probably damaging Het
Rad21 A T 15: 51,969,965 F373I probably damaging Het
Rcvrn A G 11: 67,700,054 I155V probably benign Het
Rsrc2 C T 5: 123,736,628 probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Ssc5d A T 7: 4,927,262 D114V probably damaging Het
St6gal2 C A 17: 55,482,697 P244Q probably benign Het
Tarbp1 A G 8: 126,438,799 probably benign Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Trim32 A T 4: 65,613,466 I87F possibly damaging Het
Tti2 A G 8: 31,151,147 K100E probably benign Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vps13d A G 4: 145,190,544 Y17H probably damaging Het
Zfp106 T C 2: 120,534,613 K438E probably benign Het
Zfp60 T C 7: 27,749,581 I558T probably damaging Het
Zzef1 A C 11: 72,889,040 I1880L probably benign Het
Other mutations in Tmem221
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1545:Tmem221 UTSW 8 71558538 missense probably damaging 0.99
R2012:Tmem221 UTSW 8 71555814 missense probably benign 0.41
R2116:Tmem221 UTSW 8 71557828 missense probably damaging 1.00
R4867:Tmem221 UTSW 8 71555140 missense probably benign 0.31
R5096:Tmem221 UTSW 8 71558709 missense probably damaging 0.99
R5106:Tmem221 UTSW 8 71555878 missense probably benign
R5845:Tmem221 UTSW 8 71555144 critical splice acceptor site probably null
R6334:Tmem221 UTSW 8 71558784 missense probably damaging 0.98
R6466:Tmem221 UTSW 8 71557849 missense probably damaging 1.00
R7729:Tmem221 UTSW 8 71558802 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATCTCATGAGTGACCCCATCCC -3'
(R):5'- TCAGCACTGGCCATCTATGC -3'

Sequencing Primer
(F):5'- AGTGACCCCATCCCAGGAG -3'
(R):5'- AGCAGCTGCATCCATCCTG -3'
Posted On2015-04-06