Mutagenetix > Incidental Mutation

Incidental Mutation 'R3875:Tarbp1'

276795

Institutional Source

Beutler Lab

Gene Symbol

Tarbp1

Ensembl Gene

ENSMUSG00000090290

Gene Name

TAR RNA binding protein 1

Synonyms

Gm17296

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3875 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126425329-126475065 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 126438799 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170518]

AlphaFold

E9Q368

Predicted Effect

probably benign
Transcript: ENSMUST00000170518

SMART Domains

Protein: ENSMUSP00000129815
Gene: ENSMUSG00000090290

Domain	Start	End	E-Value	Type
low complexity region	17	31	N/A	INTRINSIC
low complexity region	47	57	N/A	INTRINSIC
low complexity region	77	97	N/A	INTRINSIC
low complexity region	112	127	N/A	INTRINSIC
low complexity region	195	207	N/A	INTRINSIC
SCOP:d1gw5a_	1059	1260	3e-3	SMART
Pfam:SpoU_methylase	1421	1564	2.2e-32	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. This element forms a stable stem-loop structure and can be bound by either the protein encoded by this gene or by RNA polymerase II. This protein may act to disengage RNA polymerase II from TAR during transcriptional elongation. Alternatively spliced transcripts of this gene may exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	T	C	2: 152,434,080	S72P	probably benign	Het
Abca5	T	A	11: 110,310,233	Y447F	probably damaging	Het
Adgrg2	A	G	X: 160,478,996	S337G	probably benign	Het
Akap12	G	A	10: 4,357,590	V1467I	probably benign	Het
Baz2a	T	A	10: 128,124,110	M1419K	probably damaging	Het
Cacna1g	G	A	11: 94,437,923	T1033I	probably damaging	Het
Car12	C	A	9: 66,717,552		probably benign	Het
Cpne1	G	A	2: 156,076,282	H352Y	probably damaging	Het
D630039A03Rik	T	A	4: 57,910,606	T69S	probably benign	Het
Dhodh	T	C	8: 109,594,960	D310G	probably null	Het
Dnah2	A	G	11: 69,429,348	I3965T	probably damaging	Het
Drd5	T	G	5: 38,319,814	V50G	possibly damaging	Het
Dst	C	A	1: 34,171,247	H934Q	probably damaging	Het
Far2	G	A	6: 148,150,591	E123K	probably benign	Het
Fbxo43	A	T	15: 36,162,103	F319L	probably benign	Het
Flii	T	C	11: 60,720,492	S418G	probably benign	Het
Glyctk	T	A	9: 106,157,621	Y82F	probably damaging	Het
Gm11353	G	T	13: 26,492,668		noncoding transcript	Het
Gm6505	T	A	3: 28,765,137		noncoding transcript	Het
Gm8332	T	C	12: 88,249,706	D132G	unknown	Het
Gpr151	A	G	18: 42,578,596	V339A	probably benign	Het
H2-T22	T	C	17: 36,040,303	I296V	probably benign	Het
Igfn1	T	C	1: 135,954,614	N2831S	probably damaging	Het
Igkv13-85	A	G	6: 68,930,500	V39A	probably damaging	Het
Irx5	A	G	8: 92,360,165	T242A	probably benign	Het
Krt26	T	C	11: 99,334,744	K304E	probably damaging	Het
Mcoln1	A	G	8: 3,508,355	D203G	probably benign	Het
Mlph	T	C	1: 90,928,122	C57R	probably damaging	Het
Myh13	C	A	11: 67,358,194	H1275Q	probably benign	Het
Nbeal1	T	A	1: 60,194,599		probably benign	Het
Orc5	T	A	5: 22,537,566	M115L	probably benign	Het
Pcdha6	T	A	18: 36,968,066	I104N	probably damaging	Het
Plcb4	T	C	2: 136,002,632	S157P	probably damaging	Het
Polq	A	G	16: 37,074,027	D1787G	probably damaging	Het
Prkar2b	T	G	12: 31,965,123	I142L	probably benign	Het
Ptprq	A	G	10: 107,685,104	S736P	possibly damaging	Het
Qrich2	A	T	11: 116,445,651	V2046D	probably damaging	Het
Rad21	A	T	15: 51,969,965	F373I	probably damaging	Het
Rcvrn	A	G	11: 67,700,054	I155V	probably benign	Het
Rsrc2	C	T	5: 123,736,628		probably benign	Het
Sgsh	A	G	11: 119,350,947	L111P	probably damaging	Het
Ssc5d	A	T	7: 4,927,262	D114V	probably damaging	Het
St6gal2	C	A	17: 55,482,697	P244Q	probably benign	Het
Tmem221	T	C	8: 71,555,755		probably null	Het
Trh	A	T	6: 92,243,698	V61E	possibly damaging	Het
Trim32	A	T	4: 65,613,466	I87F	possibly damaging	Het
Tti2	A	G	8: 31,151,147	K100E	probably benign	Het
Usp34	C	T	11: 23,489,033	P3532S	possibly damaging	Het
Vps13d	A	G	4: 145,190,544	Y17H	probably damaging	Het
Zfp106	T	C	2: 120,534,613	K438E	probably benign	Het
Zfp60	T	C	7: 27,749,581	I558T	probably damaging	Het
Zzef1	A	C	11: 72,889,040	I1880L	probably benign	Het

Other mutations in Tarbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Tarbp1	APN	8	126459161	missense	probably damaging	1.00
IGL01419:Tarbp1	APN	8	126428155	missense	probably benign	0.03
IGL01475:Tarbp1	APN	8	126433962	missense	probably benign	0.03
IGL01688:Tarbp1	APN	8	126447551	missense	probably damaging	1.00
IGL01772:Tarbp1	APN	8	126447231	splice site	probably benign
IGL02402:Tarbp1	APN	8	126450828	splice site	probably benign
IGL02899:Tarbp1	APN	8	126453844	missense	probably damaging	0.96
IGL03006:Tarbp1	APN	8	126444142	missense	probably damaging	1.00
IGL03273:Tarbp1	APN	8	126453835	missense	probably damaging	1.00
PIT4280001:Tarbp1	UTSW	8	126430847	missense	probably damaging	0.96
R0048:Tarbp1	UTSW	8	126447530	missense	probably damaging	1.00
R0309:Tarbp1	UTSW	8	126438928	splice site	probably benign
R0383:Tarbp1	UTSW	8	126447484	missense	probably benign	0.00
R0455:Tarbp1	UTSW	8	126440873	missense	probably benign	0.00
R0738:Tarbp1	UTSW	8	126438801	critical splice donor site	probably null
R1345:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1370:Tarbp1	UTSW	8	126448330	missense	probably benign	0.03
R1617:Tarbp1	UTSW	8	126444268	missense	possibly damaging	0.47
R1628:Tarbp1	UTSW	8	126430860	missense	possibly damaging	0.78
R1702:Tarbp1	UTSW	8	126428218	missense	probably damaging	1.00
R1873:Tarbp1	UTSW	8	126447047	missense	probably damaging	1.00
R2018:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2019:Tarbp1	UTSW	8	126428114	missense	probably damaging	1.00
R2060:Tarbp1	UTSW	8	126447594	splice site	probably null
R2877:Tarbp1	UTSW	8	126427832	missense	probably damaging	1.00
R3008:Tarbp1	UTSW	8	126447421	missense	possibly damaging	0.46
R3905:Tarbp1	UTSW	8	126428152	missense	probably damaging	1.00
R3923:Tarbp1	UTSW	8	126440771	missense	probably benign	0.00
R4420:Tarbp1	UTSW	8	126447080	missense	possibly damaging	0.59
R4570:Tarbp1	UTSW	8	126452233	missense	probably benign	0.00
R4610:Tarbp1	UTSW	8	126474330	missense	probably damaging	1.00
R4649:Tarbp1	UTSW	8	126447195	missense	probably damaging	0.96
R4802:Tarbp1	UTSW	8	126474889	missense	possibly damaging	0.75
R4951:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R4953:Tarbp1	UTSW	8	126447445	missense	possibly damaging	0.94
R5254:Tarbp1	UTSW	8	126467156	missense	probably damaging	0.96
R5255:Tarbp1	UTSW	8	126428970	missense	probably benign	0.16
R5638:Tarbp1	UTSW	8	126450686	missense	probably damaging	1.00
R5696:Tarbp1	UTSW	8	126447340	missense	probably damaging	0.98
R5707:Tarbp1	UTSW	8	126467144	missense	probably damaging	1.00
R5896:Tarbp1	UTSW	8	126452928	missense	probably benign	0.05
R6087:Tarbp1	UTSW	8	126428970	missense	probably benign	0.00
R6117:Tarbp1	UTSW	8	126427541	missense	probably benign	0.00
R6132:Tarbp1	UTSW	8	126434809	missense	probably benign	0.17
R6168:Tarbp1	UTSW	8	126448405	missense	possibly damaging	0.89
R6419:Tarbp1	UTSW	8	126459044	missense	possibly damaging	0.95
R6482:Tarbp1	UTSW	8	126450695	missense	probably benign	0.01
R6766:Tarbp1	UTSW	8	126447400	missense	probably benign	0.41
R6775:Tarbp1	UTSW	8	126436829	missense	probably benign	0.16
R6960:Tarbp1	UTSW	8	126429039	missense	possibly damaging	0.88
R7054:Tarbp1	UTSW	8	126474495	missense	possibly damaging	0.85
R7068:Tarbp1	UTSW	8	126427034	missense	probably damaging	1.00
R7454:Tarbp1	UTSW	8	126457677	missense	probably benign	0.19
R7519:Tarbp1	UTSW	8	126433900	missense	possibly damaging	0.87
R7760:Tarbp1	UTSW	8	126452807	missense	not run
R7837:Tarbp1	UTSW	8	126474561	missense	probably benign	0.00
R7882:Tarbp1	UTSW	8	126456493	missense	probably damaging	1.00
R7982:Tarbp1	UTSW	8	126444301	missense	probably damaging	1.00
R8166:Tarbp1	UTSW	8	126427128	missense	possibly damaging	0.79
R8517:Tarbp1	UTSW	8	126444195	missense	probably benign	0.29
R8838:Tarbp1	UTSW	8	126450830	splice site	probably benign
R8880:Tarbp1	UTSW	8	126471305	missense	probably damaging	1.00
R9061:Tarbp1	UTSW	8	126447141	missense	probably damaging	1.00
R9123:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9125:Tarbp1	UTSW	8	126447463	missense	possibly damaging	0.63
R9364:Tarbp1	UTSW	8	126450723	missense	probably benign	0.01
R9474:Tarbp1	UTSW	8	126429040	missense	probably benign	0.44
R9670:Tarbp1	UTSW	8	126456523	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTCACTCATACACAGATTT -3'
(R):5'- TCACAGATGTGGTAGGAGGCT -3'

Sequencing Primer
(F):5'- GGTCCTGGCTCTTTAAGAAACCAG -3'
(R):5'- CAGATGTGGTAGGAGGCTTACCC -3'

Posted On

2015-04-06