Incidental Mutation 'R3875:Usp34'
ID 276801
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.671) question?
Stock # R3875 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 23306895-23490560 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 23489033 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 3532 (P3532S)
Ref Sequence ENSEMBL: ENSMUSP00000137430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020529] [ENSMUST00000109539] [ENSMUST00000128559] [ENSMUST00000129368] [ENSMUST00000147157] [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000020529
SMART Domains Protein: ENSMUSP00000020529
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 163 2.52e-57 SMART
Pfam:AHSA1 209 325 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109539
SMART Domains Protein: ENSMUSP00000105166
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 2 115 2.33e-38 SMART
Pfam:AHSA1 161 277 4.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125701
Predicted Effect probably benign
Transcript: ENSMUST00000128372
SMART Domains Protein: ENSMUSP00000121255
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 15 149 2.52e-57 SMART
Pfam:AHSA1 195 311 7.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128559
SMART Domains Protein: ENSMUSP00000115134
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 159 1.59e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129368
SMART Domains Protein: ENSMUSP00000121426
Gene: ENSMUSG00000056342

DomainStartEndE-ValueType
Blast:Drf_GBD 2 86 1e-19 BLAST
low complexity region 231 244 N/A INTRINSIC
coiled coil region 259 281 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137823
AA Change: P3551S
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: P3551S

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147157
SMART Domains Protein: ENSMUSP00000121920
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 138 4.15e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153409
Predicted Effect possibly damaging
Transcript: ENSMUST00000180046
AA Change: P3532S

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: P3532S

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Meta Mutation Damage Score 0.0845 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T C 2: 152,434,080 S72P probably benign Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Adgrg2 A G X: 160,478,996 S337G probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cacna1g G A 11: 94,437,923 T1033I probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cpne1 G A 2: 156,076,282 H352Y probably damaging Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dhodh T C 8: 109,594,960 D310G probably null Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Drd5 T G 5: 38,319,814 V50G possibly damaging Het
Dst C A 1: 34,171,247 H934Q probably damaging Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Fbxo43 A T 15: 36,162,103 F319L probably benign Het
Flii T C 11: 60,720,492 S418G probably benign Het
Glyctk T A 9: 106,157,621 Y82F probably damaging Het
Gm11353 G T 13: 26,492,668 noncoding transcript Het
Gm6505 T A 3: 28,765,137 noncoding transcript Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Gpr151 A G 18: 42,578,596 V339A probably benign Het
H2-T22 T C 17: 36,040,303 I296V probably benign Het
Igfn1 T C 1: 135,954,614 N2831S probably damaging Het
Igkv13-85 A G 6: 68,930,500 V39A probably damaging Het
Irx5 A G 8: 92,360,165 T242A probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Mcoln1 A G 8: 3,508,355 D203G probably benign Het
Mlph T C 1: 90,928,122 C57R probably damaging Het
Myh13 C A 11: 67,358,194 H1275Q probably benign Het
Nbeal1 T A 1: 60,194,599 probably benign Het
Orc5 T A 5: 22,537,566 M115L probably benign Het
Pcdha6 T A 18: 36,968,066 I104N probably damaging Het
Plcb4 T C 2: 136,002,632 S157P probably damaging Het
Polq A G 16: 37,074,027 D1787G probably damaging Het
Prkar2b T G 12: 31,965,123 I142L probably benign Het
Ptprq A G 10: 107,685,104 S736P possibly damaging Het
Qrich2 A T 11: 116,445,651 V2046D probably damaging Het
Rad21 A T 15: 51,969,965 F373I probably damaging Het
Rcvrn A G 11: 67,700,054 I155V probably benign Het
Rsrc2 C T 5: 123,736,628 probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Ssc5d A T 7: 4,927,262 D114V probably damaging Het
St6gal2 C A 17: 55,482,697 P244Q probably benign Het
Tarbp1 A G 8: 126,438,799 probably benign Het
Tmem221 T C 8: 71,555,755 probably null Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Trim32 A T 4: 65,613,466 I87F possibly damaging Het
Tti2 A G 8: 31,151,147 K100E probably benign Het
Vps13d A G 4: 145,190,544 Y17H probably damaging Het
Zfp106 T C 2: 120,534,613 K438E probably benign Het
Zfp60 T C 7: 27,749,581 I558T probably damaging Het
Zzef1 A C 11: 72,889,040 I1880L probably benign Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL00477:Usp34 APN 11 23468879 missense probably damaging 0.99
IGL01307:Usp34 APN 11 23417676 missense probably damaging 0.99
IGL01313:Usp34 APN 11 23473206 missense probably damaging 1.00
IGL01794:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01826:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01827:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01830:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01867:Usp34 APN 11 23384411 missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23345141 splice site probably benign
IGL01977:Usp34 APN 11 23452661 missense probably damaging 1.00
IGL01985:Usp34 APN 11 23452565 missense probably damaging 1.00
IGL02011:Usp34 APN 11 23471554 missense probably damaging 0.99
IGL02302:Usp34 APN 11 23467243 missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23354900 missense probably benign 0.11
IGL02491:Usp34 APN 11 23432630 missense probably damaging 0.98
IGL02532:Usp34 APN 11 23370291 missense probably damaging 0.99
IGL02561:Usp34 APN 11 23351652 missense probably benign 0.09
IGL02706:Usp34 APN 11 23388659 splice site probably benign
IGL02891:Usp34 APN 11 23487166 missense probably benign 0.09
IGL03079:Usp34 APN 11 23432247 missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23446958 missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23488686 missense probably benign
IGL03256:Usp34 APN 11 23420090 nonsense probably null
IGL03280:Usp34 APN 11 23354897 missense probably damaging 1.00
IGL03289:Usp34 APN 11 23393818 missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23446957 missense possibly damaging 0.92
Chub UTSW 11 23464686 missense probably damaging 0.99
Cicione UTSW 11 23489033 missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23457975 missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23343515 missense possibly damaging 0.94
Roebuck UTSW 11 23486810 splice site probably benign
stoat UTSW 11 23487203 missense
tunnelvision UTSW 11 23446968 missense
I2288:Usp34 UTSW 11 23432473 splice site probably benign
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0099:Usp34 UTSW 11 23363111 missense probably damaging 1.00
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0403:Usp34 UTSW 11 23333838 missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23401505 missense probably damaging 0.99
R0446:Usp34 UTSW 11 23467207 missense probably damaging 0.97
R0455:Usp34 UTSW 11 23446741 splice site probably benign
R0470:Usp34 UTSW 11 23436001 missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23384509 splice site probably benign
R0512:Usp34 UTSW 11 23451997 missense probably benign 0.04
R0557:Usp34 UTSW 11 23403848 missense probably damaging 0.98
R0562:Usp34 UTSW 11 23432406 splice site probably benign
R0656:Usp34 UTSW 11 23472967 missense probably damaging 0.99
R0693:Usp34 UTSW 11 23452637 missense probably damaging 0.97
R0739:Usp34 UTSW 11 23467243 missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23384420 missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23433175 splice site probably benign
R1223:Usp34 UTSW 11 23446464 splice site probably null
R1295:Usp34 UTSW 11 23384477 missense probably damaging 1.00
R1430:Usp34 UTSW 11 23459151 missense probably damaging 0.97
R1445:Usp34 UTSW 11 23351629 missense probably damaging 0.99
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1471:Usp34 UTSW 11 23488862 missense probably benign 0.20
R1475:Usp34 UTSW 11 23473253 missense probably damaging 0.99
R1628:Usp34 UTSW 11 23488725 missense probably damaging 1.00
R1631:Usp34 UTSW 11 23460651 missense probably damaging 0.99
R1655:Usp34 UTSW 11 23375051 missense probably benign 0.05
R1741:Usp34 UTSW 11 23364103 missense probably benign 0.00
R1854:Usp34 UTSW 11 23426153 missense probably benign 0.24
R1867:Usp34 UTSW 11 23361593 missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1870:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1871:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1967:Usp34 UTSW 11 23364503 missense probably benign 0.01
R2051:Usp34 UTSW 11 23464468 missense probably damaging 0.97
R2132:Usp34 UTSW 11 23464556 missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23382602 missense probably damaging 0.98
R2205:Usp34 UTSW 11 23385147 missense probably damaging 0.97
R2342:Usp34 UTSW 11 23403599 missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23370466 missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23464517 missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23343640 missense probably benign 0.28
R3972:Usp34 UTSW 11 23457803 missense probably damaging 1.00
R4018:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23417676 missense probably damaging 0.99
R4197:Usp34 UTSW 11 23444189 missense probably damaging 0.98
R4352:Usp34 UTSW 11 23320727 missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23384499 missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23435998 missense probably damaging 0.98
R4475:Usp34 UTSW 11 23457975 missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23401529 missense probably damaging 1.00
R4527:Usp34 UTSW 11 23421257 missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23464633 missense probably damaging 0.97
R4612:Usp34 UTSW 11 23432268 missense probably damaging 0.99
R4673:Usp34 UTSW 11 23364480 small deletion probably benign
R4707:Usp34 UTSW 11 23487215 missense probably damaging 1.00
R4736:Usp34 UTSW 11 23393749 splice site probably null
R4867:Usp34 UTSW 11 23451999 missense probably benign 0.28
R4879:Usp34 UTSW 11 23373410 missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23488982 missense probably damaging 1.00
R5004:Usp34 UTSW 11 23464586 missense probably damaging 1.00
R5057:Usp34 UTSW 11 23458086 intron probably benign
R5068:Usp34 UTSW 11 23460665 missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23343616 missense probably damaging 1.00
R5320:Usp34 UTSW 11 23333739 missense probably benign
R5327:Usp34 UTSW 11 23468846 missense probably damaging 1.00
R5328:Usp34 UTSW 11 23464616 missense probably benign 0.01
R5328:Usp34 UTSW 11 23488659 missense probably benign 0.04
R5390:Usp34 UTSW 11 23444202 critical splice donor site probably null
R5434:Usp34 UTSW 11 23412271 missense probably damaging 0.99
R5523:Usp34 UTSW 11 23349198 missense probably benign 0.39
R5567:Usp34 UTSW 11 23488336 missense probably damaging 0.97
R5571:Usp34 UTSW 11 23457975 missense probably damaging 0.99
R5645:Usp34 UTSW 11 23375024 missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23343515 missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23354846 missense probably benign 0.00
R5813:Usp34 UTSW 11 23421340 missense probably benign 0.38
R5921:Usp34 UTSW 11 23464686 missense probably damaging 0.99
R5928:Usp34 UTSW 11 23436040 missense probably damaging 0.98
R5944:Usp34 UTSW 11 23363089 missense probably damaging 1.00
R6198:Usp34 UTSW 11 23484127 missense probably damaging 1.00
R6229:Usp34 UTSW 11 23446778 missense probably damaging 0.99
R6306:Usp34 UTSW 11 23412260 missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23452520 missense probably damaging 0.98
R6341:Usp34 UTSW 11 23381353 missense probably damaging 0.97
R6374:Usp34 UTSW 11 23438914 missense probably damaging 1.00
R6398:Usp34 UTSW 11 23488666 missense probably benign
R6438:Usp34 UTSW 11 23364266 missense probably benign 0.02
R6668:Usp34 UTSW 11 23460659 missense probably damaging 0.97
R6700:Usp34 UTSW 11 23439011 missense probably damaging 1.00
R6783:Usp34 UTSW 11 23412318 missense probably damaging 1.00
R6821:Usp34 UTSW 11 23367491 missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23452569 missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23458023 missense probably damaging 0.98
R7020:Usp34 UTSW 11 23393954 missense probably benign 0.05
R7026:Usp34 UTSW 11 23361622 missense probably damaging 1.00
R7085:Usp34 UTSW 11 23363097 missense
R7101:Usp34 UTSW 11 23426183 missense
R7168:Usp34 UTSW 11 23464585 missense
R7192:Usp34 UTSW 11 23460571 missense
R7264:Usp34 UTSW 11 23333566 missense probably benign 0.00
R7325:Usp34 UTSW 11 23419052 missense
R7343:Usp34 UTSW 11 23488868 missense
R7358:Usp34 UTSW 11 23361683 missense probably damaging 0.99
R7369:Usp34 UTSW 11 23432361 missense
R7389:Usp34 UTSW 11 23345200 missense
R7459:Usp34 UTSW 11 23364458 missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23446968 missense
R7729:Usp34 UTSW 11 23449268 missense
R7777:Usp34 UTSW 11 23382638 missense
R7810:Usp34 UTSW 11 23412314 missense
R7836:Usp34 UTSW 11 23446614 missense
R7862:Usp34 UTSW 11 23464718 missense
R7993:Usp34 UTSW 11 23377622 missense
R8050:Usp34 UTSW 11 23446787 missense
R8054:Usp34 UTSW 11 23361295 missense
R8239:Usp34 UTSW 11 23446750 missense
R8266:Usp34 UTSW 11 23486810 splice site probably benign
R8347:Usp34 UTSW 11 23412345 missense
R8409:Usp34 UTSW 11 23457811 missense
R8692:Usp34 UTSW 11 23429325 missense
R8694:Usp34 UTSW 11 23484161 missense
R8734:Usp34 UTSW 11 23444184 missense
R8806:Usp34 UTSW 11 23484143 missense
R8914:Usp34 UTSW 11 23343604 missense
R8987:Usp34 UTSW 11 23464267 missense
R9013:Usp34 UTSW 11 23370302 missense
R9108:Usp34 UTSW 11 23370528 missense
R9264:Usp34 UTSW 11 23489064 missense
R9301:Usp34 UTSW 11 23472951 missense
R9375:Usp34 UTSW 11 23487203 missense
R9385:Usp34 UTSW 11 23449223 missense
R9500:Usp34 UTSW 11 23381337 missense probably damaging 0.99
R9566:Usp34 UTSW 11 23367529 missense
R9629:Usp34 UTSW 11 23364364 missense
R9679:Usp34 UTSW 11 23444369 missense
R9680:Usp34 UTSW 11 23367385 missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23474351 missense
R9752:Usp34 UTSW 11 23459182 missense probably benign 0.11
X0023:Usp34 UTSW 11 23375028 missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23457824 missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23473221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTAACAATGGCAGGTTTGAC -3'
(R):5'- AGCACTGGACAAACTGAAGC -3'

Sequencing Primer
(F):5'- CTAACAATGGCAGGTTTGACGACTG -3'
(R):5'- CGTGAGAATAGACATGCCACGTC -3'
Posted On 2015-04-06