Incidental Mutation 'R3876:Oprk1'
ID276823
Institutional Source Beutler Lab
Gene Symbol Oprk1
Ensembl Gene ENSMUSG00000025905
Gene Nameopioid receptor, kappa 1
SynonymsR21, KOR-1, Oprk2
MMRRC Submission 041606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3876 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location5588466-5606131 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 5602661 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 340 (C340*)
Ref Sequence ENSEMBL: ENSMUSP00000125105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027038] [ENSMUST00000160339] [ENSMUST00000160777]
Predicted Effect probably null
Transcript: ENSMUST00000027038
AA Change: C340*
SMART Domains Protein: ENSMUSP00000027038
Gene: ENSMUSG00000025905
AA Change: C340*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 280 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-67 PFAM
Pfam:7TM_GPCR_Srv 79 345 6.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159083
Predicted Effect probably null
Transcript: ENSMUST00000160339
AA Change: C340*
SMART Domains Protein: ENSMUSP00000124030
Gene: ENSMUSG00000025905
AA Change: C340*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 284 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-60 PFAM
Pfam:7TM_GPCR_Srv 78 345 5.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160777
AA Change: C340*
SMART Domains Protein: ENSMUSP00000125105
Gene: ENSMUSG00000025905
AA Change: C340*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 280 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-67 PFAM
Pfam:7TM_GPCR_Srv 79 345 6.8e-9 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes an opioid receptor, which is a member of the 7 transmembrane-spanning G protein-coupled receptor family. It functions as a receptor for endogenous ligands, as well as a receptor for various synthetic opioids. Ligand binding results in inhibition of adenylate cyclase activity and neurotransmitter release. This opioid receptor plays a role in the perception of pain and mediating the hypolocomotor, analgesic and aversive actions of synthetic opioids. Variations in this gene have also been associated with alcohol dependence and opiate addiction. Alternatively spliced transcript variants have been found for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired response to morphine and an opioid agonist, abnormal pain threshold, and increased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Chrnb4 T C 9: 55,043,898 E27G probably damaging Het
Clec14a A G 12: 58,268,644 V64A possibly damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Dpp10 T A 1: 123,353,487 Q611L probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fam184a C T 10: 53,699,061 V151I probably damaging Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 H971Q probably benign Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt34 T C 11: 100,040,965 T143A probably benign Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr5 G A 7: 6,481,132 A8V probably benign Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Pald1 T A 10: 61,347,487 N323Y probably damaging Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Prl8a6 A T 13: 27,433,032 L225* probably null Het
Psme4 T C 11: 30,856,068 S89P probably damaging Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sept3 A T 15: 82,285,801 D32V probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Stxbp2 T C 8: 3,633,369 probably null Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Oprk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Oprk1 APN 1 5598905 missense probably damaging 0.99
IGL02049:Oprk1 APN 1 5598844 missense probably damaging 1.00
IGL02076:Oprk1 APN 1 5602289 missense probably damaging 1.00
IGL02265:Oprk1 APN 1 5602648 missense probably damaging 1.00
IGL02294:Oprk1 APN 1 5602387 missense probably damaging 1.00
IGL02584:Oprk1 APN 1 5598604 missense probably damaging 1.00
IGL03164:Oprk1 APN 1 5598864 missense probably damaging 1.00
R0295:Oprk1 UTSW 1 5598850 missense possibly damaging 0.78
R1209:Oprk1 UTSW 1 5602261 missense probably benign 0.00
R1420:Oprk1 UTSW 1 5602321 missense probably damaging 1.00
R2994:Oprk1 UTSW 1 5602732 missense probably benign 0.00
R4026:Oprk1 UTSW 1 5598685 missense probably benign 0.04
R4096:Oprk1 UTSW 1 5602811 utr 3 prime probably benign
R4097:Oprk1 UTSW 1 5602811 utr 3 prime probably benign
R4475:Oprk1 UTSW 1 5602601 nonsense probably null
R5177:Oprk1 UTSW 1 5602674 missense probably damaging 1.00
R5223:Oprk1 UTSW 1 5589296 missense probably benign 0.30
R6397:Oprk1 UTSW 1 5598748 missense probably damaging 1.00
R6647:Oprk1 UTSW 1 5602284 missense probably damaging 1.00
R7169:Oprk1 UTSW 1 5589081 missense probably benign
R7170:Oprk1 UTSW 1 5602396 missense probably damaging 1.00
R8186:Oprk1 UTSW 1 5602317 missense probably benign 0.16
Z1176:Oprk1 UTSW 1 5602702 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGTCTTCATCATCTGTTGGAC -3'
(R):5'- ACCTTTCCACTTCAGACTGCAG -3'

Sequencing Primer
(F):5'- GTTGGACCCCCATTCACATC -3'
(R):5'- CACTTCAGACTGCAGTTGTAATCTGG -3'
Posted On2015-04-06