Incidental Mutation 'R3876:Dpp10'
ID 276824
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Name dipeptidylpeptidase 10
Synonyms 6430601K09Rik, DPRP3
MMRRC Submission 041606-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3876 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 123321471-124045559 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123353487 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 611 (Q611L)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000112603
AA Change: Q600L

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: Q600L

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112606
AA Change: Q611L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: Q611L

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Meta Mutation Damage Score 0.6097 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Chrnb4 T C 9: 55,043,898 E27G probably damaging Het
Clec14a A G 12: 58,268,644 V64A possibly damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fam184a C T 10: 53,699,061 V151I probably damaging Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 H971Q probably benign Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt34 T C 11: 100,040,965 T143A probably benign Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr5 G A 7: 6,481,132 A8V probably benign Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Oprk1 T A 1: 5,602,661 C340* probably null Het
Pald1 T A 10: 61,347,487 N323Y probably damaging Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Prl8a6 A T 13: 27,433,032 L225* probably null Het
Psme4 T C 11: 30,856,068 S89P probably damaging Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sept3 A T 15: 82,285,801 D32V probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Stxbp2 T C 8: 3,633,369 probably null Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123905125 missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2079:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5457:Dpp10 UTSW 1 123411810 missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123367601 missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123336851 missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6894:Dpp10 UTSW 1 123336864 missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
R7375:Dpp10 UTSW 1 123367795 missense probably benign
R7387:Dpp10 UTSW 1 123341140 missense probably benign 0.01
R7661:Dpp10 UTSW 1 123384952 missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123352660 missense probably benign
R8067:Dpp10 UTSW 1 123352660 missense probably benign
R8260:Dpp10 UTSW 1 123686295 missense probably benign
R8324:Dpp10 UTSW 1 123854172 missense probably benign 0.02
R8373:Dpp10 UTSW 1 123854229 missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123433010 missense probably damaging 1.00
R9068:Dpp10 UTSW 1 123432938 missense probably damaging 1.00
R9104:Dpp10 UTSW 1 123411755 missense probably damaging 1.00
R9477:Dpp10 UTSW 1 123376641 missense possibly damaging 0.46
R9492:Dpp10 UTSW 1 123353430 missense probably damaging 1.00
R9524:Dpp10 UTSW 1 123336882 missense probably damaging 1.00
R9576:Dpp10 UTSW 1 123341680 missense probably damaging 1.00
R9631:Dpp10 UTSW 1 123341703 missense probably damaging 1.00
R9736:Dpp10 UTSW 1 123334359 missense possibly damaging 0.64
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123353440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACACCAATAACAGTGATAGATGC -3'
(R):5'- CTGAAATGCTGGTTGCCCTTC -3'

Sequencing Primer
(F):5'- TGCTAATTTGAGAAAAGAGACATCTC -3'
(R):5'- GGTTGCCCTTCTTTTGATCAAG -3'
Posted On 2015-04-06