Mutagenetix > Incidental Mutation

Incidental Mutation 'R3876:Kirrel'

276835

Institutional Source

Beutler Lab

Gene Symbol

Kirrel

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

Kirrel1, 6720469N11Rik, Neph1

MMRRC Submission

041606-MU

Accession Numbers

Genbank: NM_130867; MGI: 1891396

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3876 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87078593-87174747 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 87089151 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 380 (M380I)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

AlphaFold

Q80W68

Predicted Effect

probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Meta Mutation Damage Score

0.0922

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	G	A	14: 54,591,400	R215*	probably null	Het
Brinp2	C	A	1: 158,246,846	L568F	probably damaging	Het
Brip1	T	C	11: 86,152,790	Y316C	probably damaging	Het
Cdk5rap2	ATGTG	ATG	4: 70,289,977		probably null	Het
Cfap69	G	T	5: 5,584,645		probably benign	Het
Chrnb4	T	C	9: 55,043,898	E27G	probably damaging	Het
Clec14a	A	G	12: 58,268,644	V64A	possibly damaging	Het
Crygs	A	G	16: 22,806,512	Y60H	probably damaging	Het
Dpp10	T	A	1: 123,353,487	Q611L	probably damaging	Het
Entpd1	T	C	19: 40,736,820	L450P	probably damaging	Het
Eogt	G	A	6: 97,120,190	S317L	probably damaging	Het
Exosc10	T	A	4: 148,572,919	S584T	probably benign	Het
Fam184a	C	T	10: 53,699,061	V151I	probably damaging	Het
Fbxo43	A	G	15: 36,152,112	V517A	probably damaging	Het
Flii	T	C	11: 60,719,872	T533A	possibly damaging	Het
Frmpd1	T	G	4: 45,284,093	H971Q	probably benign	Het
Gata3	A	T	2: 9,863,143	N333K	probably damaging	Het
Hectd1	A	G	12: 51,768,730	S1525P	probably damaging	Het
Ibtk	A	G	9: 85,718,426	I816T	probably benign	Het
Krt34	T	C	11: 100,040,965	T143A	probably benign	Het
Lipn	G	T	19: 34,069,428	M43I	probably benign	Het
Lrp1b	A	G	2: 41,445,194	C779R	probably damaging	Het
Mios	G	A	6: 8,233,189	R779Q	probably damaging	Het
Mme	A	T	3: 63,362,059		probably benign	Het
Ncstn	A	G	1: 172,070,073	S418P	probably benign	Het
Olfr1209	T	C	2: 88,909,608	T262A	possibly damaging	Het
Olfr1285	T	C	2: 111,408,622	V69A	possibly damaging	Het
Olfr5	G	A	7: 6,481,132	A8V	probably benign	Het
Olfr800	C	T	10: 129,660,274	P156L	probably benign	Het
Olfr934	T	A	9: 38,982,870	Y58F	probably damaging	Het
Oprk1	T	A	1: 5,602,661	C340*	probably null	Het
Pald1	T	A	10: 61,347,487	N323Y	probably damaging	Het
Pcdhac1	C	A	18: 37,091,892	A586E	probably damaging	Het
Pcnx2	C	T	8: 125,888,158	A185T	probably benign	Het
Pik3r1	G	A	13: 101,684,957	H430Y	probably benign	Het
Polr3b	G	A	10: 84,720,518		probably null	Het
Prl8a6	A	T	13: 27,433,032	L225*	probably null	Het
Psme4	T	C	11: 30,856,068	S89P	probably damaging	Het
Pygl	G	A	12: 70,201,339	T250I	probably damaging	Het
Rgs13	T	A	1: 144,140,790	K72*	probably null	Het
Ryr2	T	A	13: 11,588,159	I4514F	probably damaging	Het
Sept3	A	T	15: 82,285,801	D32V	probably damaging	Het
Sfrp2	C	T	3: 83,767,028	P163S	possibly damaging	Het
Spata31	A	G	13: 64,920,931	T298A	probably benign	Het
Stxbp2	T	C	8: 3,633,369		probably null	Het
Syne1	A	T	10: 5,052,345	M282K	possibly damaging	Het
Timd2	T	C	11: 46,671,020		probably null	Het
Tlr11	G	A	14: 50,363,154	V866I	probably benign	Het
Trappc10	T	C	10: 78,220,186		probably null	Het
Zfp512b	AG	AGG	2: 181,588,763		probably null	Het

Other mutations in Kirrel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel	APN	3	87089875	missense	probably benign	0.22
IGL01865:Kirrel	APN	3	87086424	missense	probably damaging	1.00
IGL01875:Kirrel	APN	3	87095730	missense	probably damaging	1.00
IGL02337:Kirrel	APN	3	87089212	missense	possibly damaging	0.64
IGL02724:Kirrel	APN	3	87090473	nonsense	probably null
IGL02825:Kirrel	APN	3	87089288	splice site	probably benign
IGL02826:Kirrel	APN	3	87088485	missense	probably damaging	1.00
IGL03102:Kirrel	APN	3	87083500	missense	probably damaging	0.98
D4043:Kirrel	UTSW	3	87083203	missense	probably benign	0.02
R0360:Kirrel	UTSW	3	87089799	missense	probably damaging	1.00
R0364:Kirrel	UTSW	3	87089799	missense	probably damaging	1.00
R0421:Kirrel	UTSW	3	87083607	missense	probably damaging	0.99
R0503:Kirrel	UTSW	3	87097802	missense	probably benign	0.20
R1112:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1116:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1144:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1147:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1147:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1190:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1226:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1501:Kirrel	UTSW	3	87090472	missense	probably benign	0.02
R1538:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1546:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1628:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1630:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1631:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1664:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1671:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1695:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1769:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1807:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1808:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1840:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1876:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1995:Kirrel	UTSW	3	87095786	missense	possibly damaging	0.88
R2014:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2086:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2108:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2354:Kirrel	UTSW	3	87088485	missense	probably damaging	0.98
R2407:Kirrel	UTSW	3	87084843	missense	probably benign	0.03
R2904:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2905:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2958:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2959:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2960:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2961:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3026:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3028:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3034:Kirrel	UTSW	3	87083439	missense	possibly damaging	0.56
R3149:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3195:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3196:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3499:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3699:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3720:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3721:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3788:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3793:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3877:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3901:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3910:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3911:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3912:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3913:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3930:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3931:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4022:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4067:Kirrel	UTSW	3	87088467	nonsense	probably null
R4077:Kirrel	UTSW	3	87085080	critical splice donor site	probably null
R4198:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4328:Kirrel	UTSW	3	87084774	intron	probably benign
R4355:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4363:Kirrel	UTSW	3	87090485	nonsense	probably null
R4378:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4386:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4460:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4468:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4469:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4650:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4652:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4734:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4748:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4749:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R5304:Kirrel	UTSW	3	87089595	missense	probably benign	0.02
R5534:Kirrel	UTSW	3	87090518	missense	probably damaging	1.00
R5604:Kirrel	UTSW	3	87089155	missense	possibly damaging	0.69
R7199:Kirrel	UTSW	3	87083388	missense	probably benign	0.02
R7221:Kirrel	UTSW	3	87086397	nonsense	probably null
R7284:Kirrel	UTSW	3	87083387	missense	probably benign	0.02
R7332:Kirrel	UTSW	3	87088398	missense	probably benign	0.14
R7369:Kirrel	UTSW	3	87141084	missense	probably benign	0.20
R7371:Kirrel	UTSW	3	87088422	missense	probably benign	0.44
R7508:Kirrel	UTSW	3	87083439	missense	possibly damaging	0.56
R7566:Kirrel	UTSW	3	87088484	missense	probably damaging	1.00
R7567:Kirrel	UTSW	3	87095681	missense	probably damaging	0.99
R7621:Kirrel	UTSW	3	87088221	missense	possibly damaging	0.70
R8030:Kirrel	UTSW	3	87097775	missense	probably damaging	1.00
R8141:Kirrel	UTSW	3	87086428	nonsense	probably null
R8261:Kirrel	UTSW	3	87088002	intron	probably benign
R8477:Kirrel	UTSW	3	87084831	missense	possibly damaging	0.71
R8512:Kirrel	UTSW	3	87088227	missense	probably benign	0.00
R8954:Kirrel	UTSW	3	87089866	missense	probably benign	0.25
R8987:Kirrel	UTSW	3	87085093	missense	probably damaging	1.00
R9058:Kirrel	UTSW	3	87085135	missense	probably benign	0.18
R9146:Kirrel	UTSW	3	87095708	missense	probably damaging	1.00
R9311:Kirrel	UTSW	3	87097816	missense	probably benign	0.29
R9527:Kirrel	UTSW	3	87089605	nonsense	probably null
R9629:Kirrel	UTSW	3	87095718	nonsense	probably null
Z1177:Kirrel	UTSW	3	87083875	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCCTGAGTTCTATGCAAGTCC -3'
(R):5'- AGCTGATGATTCTCAGGCAC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'

Posted On

2015-04-06