Incidental Mutation 'R3876:Frmpd1'
ID276836
Institutional Source Beutler Lab
Gene Symbol Frmpd1
Ensembl Gene ENSMUSG00000035615
Gene NameFERM and PDZ domain containing 1
Synonyms
MMRRC Submission 041606-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3876 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45184875-45285936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45284093 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 971 (H971Q)
Ref Sequence ENSEMBL: ENSMUSP00000103434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044773] [ENSMUST00000107804]
Predicted Effect probably benign
Transcript: ENSMUST00000044773
AA Change: H971Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000047232
Gene: ENSMUSG00000035615
AA Change: H971Q

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107804
AA Change: H971Q

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000103434
Gene: ENSMUSG00000035615
AA Change: H971Q

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Chrnb4 T C 9: 55,043,898 E27G probably damaging Het
Clec14a A G 12: 58,268,644 V64A possibly damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Dpp10 T A 1: 123,353,487 Q611L probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fam184a C T 10: 53,699,061 V151I probably damaging Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt34 T C 11: 100,040,965 T143A probably benign Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr5 G A 7: 6,481,132 A8V probably benign Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Oprk1 T A 1: 5,602,661 C340* probably null Het
Pald1 T A 10: 61,347,487 N323Y probably damaging Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Prl8a6 A T 13: 27,433,032 L225* probably null Het
Psme4 T C 11: 30,856,068 S89P probably damaging Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sept3 A T 15: 82,285,801 D32V probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Stxbp2 T C 8: 3,633,369 probably null Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Frmpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Frmpd1 APN 4 45279456 missense possibly damaging 0.61
IGL01678:Frmpd1 APN 4 45243717 missense probably damaging 1.00
IGL01815:Frmpd1 APN 4 45284239 missense probably benign
IGL02305:Frmpd1 APN 4 45249209 missense probably damaging 1.00
IGL02347:Frmpd1 APN 4 45270023 splice site probably null
IGL02586:Frmpd1 APN 4 45285160 missense probably damaging 1.00
IGL02704:Frmpd1 APN 4 45285082 missense possibly damaging 0.83
IGL02942:Frmpd1 APN 4 45285493 missense probably damaging 0.99
IGL03353:Frmpd1 APN 4 45261926 missense probably damaging 1.00
IGL03355:Frmpd1 APN 4 45279140 missense probably damaging 1.00
IGL03401:Frmpd1 APN 4 45284383 missense probably benign 0.28
IGL03047:Frmpd1 UTSW 4 45283993 missense probably damaging 1.00
R0094:Frmpd1 UTSW 4 45284899 nonsense probably null
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0375:Frmpd1 UTSW 4 45284196 missense probably benign 0.00
R0508:Frmpd1 UTSW 4 45284938 missense unknown
R0524:Frmpd1 UTSW 4 45256902 missense probably damaging 1.00
R0524:Frmpd1 UTSW 4 45283774 missense probably benign 0.00
R0625:Frmpd1 UTSW 4 45284055 missense probably benign
R0825:Frmpd1 UTSW 4 45285394 missense possibly damaging 0.93
R0926:Frmpd1 UTSW 4 45268497 missense probably damaging 1.00
R0975:Frmpd1 UTSW 4 45279000 missense probably benign 0.01
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1573:Frmpd1 UTSW 4 45283932 missense probably benign 0.01
R1938:Frmpd1 UTSW 4 45283711 missense probably damaging 1.00
R2334:Frmpd1 UTSW 4 45285408 missense probably damaging 0.97
R2413:Frmpd1 UTSW 4 45278969 missense probably benign 0.02
R2760:Frmpd1 UTSW 4 45244667 missense possibly damaging 0.77
R3856:Frmpd1 UTSW 4 45283698 missense probably damaging 1.00
R4080:Frmpd1 UTSW 4 45284382 missense probably benign
R4597:Frmpd1 UTSW 4 45274441 missense probably benign 0.12
R4714:Frmpd1 UTSW 4 45284785 missense probably benign 0.11
R4779:Frmpd1 UTSW 4 45229865 missense probably damaging 1.00
R4957:Frmpd1 UTSW 4 45273099 missense probably damaging 1.00
R5000:Frmpd1 UTSW 4 45261931 splice site probably null
R5041:Frmpd1 UTSW 4 45278878 missense probably damaging 1.00
R5228:Frmpd1 UTSW 4 45284322 missense probably damaging 0.98
R5413:Frmpd1 UTSW 4 45249196 missense probably benign 0.00
R5560:Frmpd1 UTSW 4 45243697 missense probably damaging 1.00
R6133:Frmpd1 UTSW 4 45284915 missense probably benign 0.01
R6158:Frmpd1 UTSW 4 45285401 missense probably damaging 1.00
R6329:Frmpd1 UTSW 4 45268551 missense possibly damaging 0.80
R6338:Frmpd1 UTSW 4 45274489 missense probably benign 0.00
R6544:Frmpd1 UTSW 4 45279024 missense probably damaging 1.00
R6728:Frmpd1 UTSW 4 45284664 missense probably benign
R6748:Frmpd1 UTSW 4 45274397 missense probably benign 0.08
R6798:Frmpd1 UTSW 4 45284850 missense probably benign 0.17
R6828:Frmpd1 UTSW 4 45275383 missense probably damaging 0.99
R7002:Frmpd1 UTSW 4 45284200 missense probably benign
R7258:Frmpd1 UTSW 4 45269974 missense possibly damaging 0.79
R7295:Frmpd1 UTSW 4 45285700 missense probably damaging 1.00
R7382:Frmpd1 UTSW 4 45278880 missense probably benign 0.00
R7423:Frmpd1 UTSW 4 45256948 missense probably damaging 1.00
R7451:Frmpd1 UTSW 4 45279558 missense probably benign 0.11
R7492:Frmpd1 UTSW 4 45285237 missense possibly damaging 0.71
R7524:Frmpd1 UTSW 4 45271181 missense probably benign 0.16
R7610:Frmpd1 UTSW 4 45279098 missense probably damaging 1.00
R7719:Frmpd1 UTSW 4 45284841 missense possibly damaging 0.52
R7724:Frmpd1 UTSW 4 45229888 missense probably damaging 1.00
R7891:Frmpd1 UTSW 4 45284478 missense probably benign 0.06
R7974:Frmpd1 UTSW 4 45284478 missense probably benign 0.06
R8010:Frmpd1 UTSW 4 45284272 missense possibly damaging 0.51
Z1088:Frmpd1 UTSW 4 45284080 missense possibly damaging 0.93
Z1177:Frmpd1 UTSW 4 45275272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCAGCCTCCAGGATCATGG -3'
(R):5'- GAGCCTATTTCTGACCGCAC -3'

Sequencing Primer
(F):5'- CAGCCTCCAGGATCATGGAGATG -3'
(R):5'- CAGCTCTGATGTGTCTCCTTGAGAG -3'
Posted On2015-04-06