Incidental Mutation 'R3876:Mios'
ID 276840
Institutional Source Beutler Lab
Gene Symbol Mios
Ensembl Gene ENSMUSG00000042447
Gene Name meiosis regulator for oocyte development
Synonyms
MMRRC Submission 041606-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R3876 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 8209222-8236274 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 8233189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 779 (R779Q)
Ref Sequence ENSEMBL: ENSMUSP00000039301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040017]
AlphaFold Q8VE19
Predicted Effect probably damaging
Transcript: ENSMUST00000040017
AA Change: R779Q

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039301
Gene: ENSMUSG00000042447
AA Change: R779Q

DomainStartEndE-ValueType
Blast:WD40 49 91 2e-18 BLAST
WD40 101 146 2.05e1 SMART
WD40 174 212 3.55e1 SMART
WD40 214 252 2.45e2 SMART
WD40 256 297 6.42e-1 SMART
Blast:WD40 312 354 2e-13 BLAST
Pfam:zinc_ribbon_16 737 861 1.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161134
Meta Mutation Damage Score 0.1954 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,828,857 (GRCm39) R215* probably null Het
Brinp2 C A 1: 158,074,416 (GRCm39) L568F probably damaging Het
Brip1 T C 11: 86,043,616 (GRCm39) Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,208,214 (GRCm39) probably null Het
Cfap69 G T 5: 5,634,645 (GRCm39) probably benign Het
Chrnb4 T C 9: 54,951,182 (GRCm39) E27G probably damaging Het
Clec14a A G 12: 58,315,430 (GRCm39) V64A possibly damaging Het
Crygs A G 16: 22,625,262 (GRCm39) Y60H probably damaging Het
Dpp10 T A 1: 123,281,216 (GRCm39) Q611L probably damaging Het
Entpd1 T C 19: 40,725,264 (GRCm39) L450P probably damaging Het
Eogt G A 6: 97,097,151 (GRCm39) S317L probably damaging Het
Exosc10 T A 4: 148,657,376 (GRCm39) S584T probably benign Het
Fam184a C T 10: 53,575,157 (GRCm39) V151I probably damaging Het
Fbxo43 A G 15: 36,152,258 (GRCm39) V517A probably damaging Het
Flii T C 11: 60,610,698 (GRCm39) T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 (GRCm39) H971Q probably benign Het
Gata3 A T 2: 9,867,954 (GRCm39) N333K probably damaging Het
Hectd1 A G 12: 51,815,513 (GRCm39) S1525P probably damaging Het
Ibtk A G 9: 85,600,479 (GRCm39) I816T probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt34 T C 11: 99,931,791 (GRCm39) T143A probably benign Het
Lipn G T 19: 34,046,828 (GRCm39) M43I probably benign Het
Lrp1b A G 2: 41,335,206 (GRCm39) C779R probably damaging Het
Mme A T 3: 63,269,480 (GRCm39) probably benign Het
Ncstn A G 1: 171,897,640 (GRCm39) S418P probably benign Het
Oprk1 T A 1: 5,672,884 (GRCm39) C340* probably null Het
Or10d1c T A 9: 38,894,166 (GRCm39) Y58F probably damaging Het
Or4c29 T C 2: 88,739,952 (GRCm39) T262A possibly damaging Het
Or4k39 T C 2: 111,238,967 (GRCm39) V69A possibly damaging Het
Or6c210 C T 10: 129,496,143 (GRCm39) P156L probably benign Het
Or6z7 G A 7: 6,484,131 (GRCm39) A8V probably benign Het
Pald1 T A 10: 61,183,266 (GRCm39) N323Y probably damaging Het
Pcdhac1 C A 18: 37,224,945 (GRCm39) A586E probably damaging Het
Pcnx2 C T 8: 126,614,897 (GRCm39) A185T probably benign Het
Pik3r1 G A 13: 101,821,465 (GRCm39) H430Y probably benign Het
Polr3b G A 10: 84,556,382 (GRCm39) probably null Het
Prl8a6 A T 13: 27,617,015 (GRCm39) L225* probably null Het
Psme4 T C 11: 30,806,068 (GRCm39) S89P probably damaging Het
Pygl G A 12: 70,248,113 (GRCm39) T250I probably damaging Het
Rgs13 T A 1: 144,016,528 (GRCm39) K72* probably null Het
Ryr2 T A 13: 11,603,045 (GRCm39) I4514F probably damaging Het
Septin3 A T 15: 82,170,002 (GRCm39) D32V probably damaging Het
Sfrp2 C T 3: 83,674,335 (GRCm39) P163S possibly damaging Het
Spata31 A G 13: 65,068,745 (GRCm39) T298A probably benign Het
Stxbp2 T C 8: 3,683,369 (GRCm39) probably null Het
Syne1 A T 10: 5,002,345 (GRCm39) M282K possibly damaging Het
Timd2 T C 11: 46,561,847 (GRCm39) probably null Het
Tlr11 G A 14: 50,600,611 (GRCm39) V866I probably benign Het
Trappc10 T C 10: 78,056,020 (GRCm39) probably null Het
Zfp512b AG AGG 2: 181,230,556 (GRCm39) probably null Het
Other mutations in Mios
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mios APN 6 8,234,363 (GRCm39) critical splice donor site probably null
IGL01365:Mios APN 6 8,216,089 (GRCm39) nonsense probably null
IGL01548:Mios APN 6 8,234,252 (GRCm39) missense possibly damaging 0.90
IGL01898:Mios APN 6 8,222,668 (GRCm39) missense probably benign 0.03
IGL02110:Mios APN 6 8,215,565 (GRCm39) missense probably damaging 1.00
IGL02308:Mios APN 6 8,231,269 (GRCm39) missense probably benign 0.06
IGL02375:Mios APN 6 8,222,598 (GRCm39) missense probably benign 0.02
IGL02452:Mios APN 6 8,222,492 (GRCm39) missense probably benign 0.01
IGL02670:Mios APN 6 8,235,378 (GRCm39) splice site probably benign
IGL03083:Mios APN 6 8,215,156 (GRCm39) missense probably damaging 1.00
R0462:Mios UTSW 6 8,215,743 (GRCm39) missense probably benign 0.11
R0591:Mios UTSW 6 8,215,470 (GRCm39) missense possibly damaging 0.52
R1351:Mios UTSW 6 8,228,120 (GRCm39) missense possibly damaging 0.70
R1476:Mios UTSW 6 8,234,237 (GRCm39) missense probably benign 0.01
R1802:Mios UTSW 6 8,216,385 (GRCm39) nonsense probably null
R1959:Mios UTSW 6 8,215,437 (GRCm39) missense probably benign 0.17
R1964:Mios UTSW 6 8,215,798 (GRCm39) missense probably damaging 0.99
R2272:Mios UTSW 6 8,226,865 (GRCm39) missense possibly damaging 0.71
R2915:Mios UTSW 6 8,214,935 (GRCm39) missense possibly damaging 0.72
R3852:Mios UTSW 6 8,216,453 (GRCm39) missense probably benign 0.09
R3948:Mios UTSW 6 8,215,496 (GRCm39) missense probably benign
R4698:Mios UTSW 6 8,228,113 (GRCm39) missense possibly damaging 0.60
R4785:Mios UTSW 6 8,222,464 (GRCm39) missense probably benign
R4789:Mios UTSW 6 8,235,429 (GRCm39) missense probably benign 0.06
R4866:Mios UTSW 6 8,214,857 (GRCm39) missense probably damaging 1.00
R4878:Mios UTSW 6 8,215,094 (GRCm39) missense probably benign 0.00
R4991:Mios UTSW 6 8,215,847 (GRCm39) missense probably benign 0.00
R5479:Mios UTSW 6 8,215,314 (GRCm39) missense probably benign 0.00
R5714:Mios UTSW 6 8,215,434 (GRCm39) missense probably damaging 0.99
R6030:Mios UTSW 6 8,215,704 (GRCm39) missense probably benign 0.11
R6030:Mios UTSW 6 8,215,704 (GRCm39) missense probably benign 0.11
R6111:Mios UTSW 6 8,214,836 (GRCm39) missense probably benign 0.01
R6455:Mios UTSW 6 8,231,239 (GRCm39) missense probably benign 0.03
R7381:Mios UTSW 6 8,216,064 (GRCm39) missense probably damaging 0.98
R8350:Mios UTSW 6 8,227,998 (GRCm39) missense probably benign 0.00
R8708:Mios UTSW 6 8,234,255 (GRCm39) missense probably benign 0.17
R8913:Mios UTSW 6 8,215,924 (GRCm39) missense probably benign
R9062:Mios UTSW 6 8,233,221 (GRCm39) missense probably benign 0.00
R9359:Mios UTSW 6 8,214,894 (GRCm39) missense probably benign 0.17
R9521:Mios UTSW 6 8,233,171 (GRCm39) missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CCTAGTCAGATGGATTACTTTGCAATG -3'
(R):5'- TCTGAAATACCAGTAGGAGCCATG -3'

Sequencing Primer
(F):5'- CAGATGGATTACTTTGCAATGTAAAG -3'
(R):5'- TCAACTTTAAGTTAGCATCTGTGAG -3'
Posted On 2015-04-06