Incidental Mutation 'R3876:Eogt'
ID 276841
Institutional Source Beutler Lab
Gene Symbol Eogt
Ensembl Gene ENSMUSG00000035245
Gene Name EGF domain specific O-linked N-acetylglucosamine transferase
Synonyms A130022J15Rik
MMRRC Submission 041606-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.188) question?
Stock # R3876 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 97086985-97126143 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 97097151 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 317 (S317L)
Ref Sequence ENSEMBL: ENSMUSP00000061610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054344] [ENSMUST00000113387]
AlphaFold Q8BYW9
Predicted Effect probably damaging
Transcript: ENSMUST00000054344
AA Change: S317L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061610
Gene: ENSMUSG00000035245
AA Change: S317L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:DUF563 245 472 1.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113387
SMART Domains Protein: ENSMUSP00000109014
Gene: ENSMUSG00000035245

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135187
Meta Mutation Damage Score 0.3792 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that acts in the lumen of the endoplasmic reticulum to catalyze the transfer of N-acetylglucosamine to serine or threonine residues of extracellular-targeted proteins. This enzyme modifies proteins containing eukaryotic growth factor (EGF)-like domains, including the Notch receptor, thereby regulating developmental signalling. Mutations in this gene have been observed in individuals with Adams-Oliver syndrome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,828,857 (GRCm39) R215* probably null Het
Brinp2 C A 1: 158,074,416 (GRCm39) L568F probably damaging Het
Brip1 T C 11: 86,043,616 (GRCm39) Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,208,214 (GRCm39) probably null Het
Cfap69 G T 5: 5,634,645 (GRCm39) probably benign Het
Chrnb4 T C 9: 54,951,182 (GRCm39) E27G probably damaging Het
Clec14a A G 12: 58,315,430 (GRCm39) V64A possibly damaging Het
Crygs A G 16: 22,625,262 (GRCm39) Y60H probably damaging Het
Dpp10 T A 1: 123,281,216 (GRCm39) Q611L probably damaging Het
Entpd1 T C 19: 40,725,264 (GRCm39) L450P probably damaging Het
Exosc10 T A 4: 148,657,376 (GRCm39) S584T probably benign Het
Fam184a C T 10: 53,575,157 (GRCm39) V151I probably damaging Het
Fbxo43 A G 15: 36,152,258 (GRCm39) V517A probably damaging Het
Flii T C 11: 60,610,698 (GRCm39) T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 (GRCm39) H971Q probably benign Het
Gata3 A T 2: 9,867,954 (GRCm39) N333K probably damaging Het
Hectd1 A G 12: 51,815,513 (GRCm39) S1525P probably damaging Het
Ibtk A G 9: 85,600,479 (GRCm39) I816T probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt34 T C 11: 99,931,791 (GRCm39) T143A probably benign Het
Lipn G T 19: 34,046,828 (GRCm39) M43I probably benign Het
Lrp1b A G 2: 41,335,206 (GRCm39) C779R probably damaging Het
Mios G A 6: 8,233,189 (GRCm39) R779Q probably damaging Het
Mme A T 3: 63,269,480 (GRCm39) probably benign Het
Ncstn A G 1: 171,897,640 (GRCm39) S418P probably benign Het
Oprk1 T A 1: 5,672,884 (GRCm39) C340* probably null Het
Or10d1c T A 9: 38,894,166 (GRCm39) Y58F probably damaging Het
Or4c29 T C 2: 88,739,952 (GRCm39) T262A possibly damaging Het
Or4k39 T C 2: 111,238,967 (GRCm39) V69A possibly damaging Het
Or6c210 C T 10: 129,496,143 (GRCm39) P156L probably benign Het
Or6z7 G A 7: 6,484,131 (GRCm39) A8V probably benign Het
Pald1 T A 10: 61,183,266 (GRCm39) N323Y probably damaging Het
Pcdhac1 C A 18: 37,224,945 (GRCm39) A586E probably damaging Het
Pcnx2 C T 8: 126,614,897 (GRCm39) A185T probably benign Het
Pik3r1 G A 13: 101,821,465 (GRCm39) H430Y probably benign Het
Polr3b G A 10: 84,556,382 (GRCm39) probably null Het
Prl8a6 A T 13: 27,617,015 (GRCm39) L225* probably null Het
Psme4 T C 11: 30,806,068 (GRCm39) S89P probably damaging Het
Pygl G A 12: 70,248,113 (GRCm39) T250I probably damaging Het
Rgs13 T A 1: 144,016,528 (GRCm39) K72* probably null Het
Ryr2 T A 13: 11,603,045 (GRCm39) I4514F probably damaging Het
Septin3 A T 15: 82,170,002 (GRCm39) D32V probably damaging Het
Sfrp2 C T 3: 83,674,335 (GRCm39) P163S possibly damaging Het
Spata31 A G 13: 65,068,745 (GRCm39) T298A probably benign Het
Stxbp2 T C 8: 3,683,369 (GRCm39) probably null Het
Syne1 A T 10: 5,002,345 (GRCm39) M282K possibly damaging Het
Timd2 T C 11: 46,561,847 (GRCm39) probably null Het
Tlr11 G A 14: 50,600,611 (GRCm39) V866I probably benign Het
Trappc10 T C 10: 78,056,020 (GRCm39) probably null Het
Zfp512b AG AGG 2: 181,230,556 (GRCm39) probably null Het
Other mutations in Eogt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Eogt APN 6 97,096,961 (GRCm39) missense probably damaging 0.97
IGL01292:Eogt APN 6 97,120,988 (GRCm39) missense possibly damaging 0.88
IGL02332:Eogt APN 6 97,102,566 (GRCm39) missense probably damaging 1.00
IGL02439:Eogt APN 6 97,120,934 (GRCm39) missense possibly damaging 0.83
disappointment UTSW 6 97,120,926 (GRCm39) missense probably benign 0.00
lovelorn UTSW 6 97,090,875 (GRCm39) missense probably damaging 1.00
mournful UTSW 6 97,095,915 (GRCm39) splice site probably null
predawn UTSW 6 97,112,245 (GRCm39) splice site probably benign
Underachiever UTSW 6 97,097,162 (GRCm39) missense probably benign 0.01
R0019:Eogt UTSW 6 97,111,234 (GRCm39) unclassified probably benign
R0112:Eogt UTSW 6 97,112,245 (GRCm39) splice site probably benign
R0325:Eogt UTSW 6 97,090,916 (GRCm39) missense probably damaging 0.99
R0497:Eogt UTSW 6 97,112,194 (GRCm39) missense probably benign 0.00
R0730:Eogt UTSW 6 97,092,970 (GRCm39) nonsense probably null
R1730:Eogt UTSW 6 97,090,825 (GRCm39) missense probably damaging 1.00
R1783:Eogt UTSW 6 97,090,825 (GRCm39) missense probably damaging 1.00
R2074:Eogt UTSW 6 97,108,337 (GRCm39) missense probably benign 0.02
R2279:Eogt UTSW 6 97,111,262 (GRCm39) missense probably benign 0.28
R2679:Eogt UTSW 6 97,097,761 (GRCm39) missense probably benign 0.01
R2993:Eogt UTSW 6 97,095,915 (GRCm39) splice site probably null
R3176:Eogt UTSW 6 97,108,355 (GRCm39) missense probably benign 0.21
R3276:Eogt UTSW 6 97,108,355 (GRCm39) missense probably benign 0.21
R3940:Eogt UTSW 6 97,090,875 (GRCm39) missense probably damaging 1.00
R4613:Eogt UTSW 6 97,111,265 (GRCm39) missense probably benign 0.00
R4704:Eogt UTSW 6 97,090,813 (GRCm39) missense probably damaging 0.99
R4849:Eogt UTSW 6 97,093,016 (GRCm39) missense probably damaging 0.99
R4867:Eogt UTSW 6 97,097,108 (GRCm39) intron probably benign
R4905:Eogt UTSW 6 97,119,792 (GRCm39) missense probably benign 0.01
R5120:Eogt UTSW 6 97,111,276 (GRCm39) missense probably benign
R5143:Eogt UTSW 6 97,102,545 (GRCm39) missense probably damaging 1.00
R5594:Eogt UTSW 6 97,092,996 (GRCm39) missense probably benign 0.01
R6351:Eogt UTSW 6 97,097,155 (GRCm39) missense probably damaging 1.00
R6418:Eogt UTSW 6 97,122,353 (GRCm39) missense possibly damaging 0.77
R6498:Eogt UTSW 6 97,112,174 (GRCm39) missense probably damaging 1.00
R6950:Eogt UTSW 6 97,111,343 (GRCm39) missense possibly damaging 0.77
R7114:Eogt UTSW 6 97,092,965 (GRCm39) missense probably damaging 1.00
R7185:Eogt UTSW 6 97,097,139 (GRCm39) missense probably damaging 1.00
R7221:Eogt UTSW 6 97,089,685 (GRCm39) missense probably damaging 1.00
R7232:Eogt UTSW 6 97,096,944 (GRCm39) missense probably damaging 0.98
R7467:Eogt UTSW 6 97,119,794 (GRCm39) missense probably benign 0.01
R7526:Eogt UTSW 6 97,090,913 (GRCm39) missense probably damaging 1.00
R7672:Eogt UTSW 6 97,090,870 (GRCm39) missense probably damaging 1.00
R7851:Eogt UTSW 6 97,097,162 (GRCm39) missense probably benign 0.01
R7956:Eogt UTSW 6 97,120,926 (GRCm39) missense probably benign 0.00
R8021:Eogt UTSW 6 97,111,291 (GRCm39) missense probably damaging 1.00
R8475:Eogt UTSW 6 97,122,327 (GRCm39) nonsense probably null
R8508:Eogt UTSW 6 97,120,959 (GRCm39) missense possibly damaging 0.67
R8550:Eogt UTSW 6 97,089,033 (GRCm39) missense probably benign 0.20
R8854:Eogt UTSW 6 97,108,359 (GRCm39) nonsense probably null
R9149:Eogt UTSW 6 97,090,839 (GRCm39) missense probably damaging 1.00
R9258:Eogt UTSW 6 97,089,043 (GRCm39) missense possibly damaging 0.86
R9500:Eogt UTSW 6 97,096,992 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GATGTTCAGCCTATGCAGCAC -3'
(R):5'- CTGTGGTGTCTACCCTATGAAG -3'

Sequencing Primer
(F):5'- CTGGGAGAAGGCTCTGAATAATCCTG -3'
(R):5'- CCTATGAAGGGTGCATACCTTGC -3'
Posted On 2015-04-06