Incidental Mutation 'R3876:Olfr5'
ID276842
Institutional Source Beutler Lab
Gene Symbol Olfr5
Ensembl Gene ENSMUSG00000096228
Gene Nameolfactory receptor 5
SynonymsMOR103-8, GA_x6K02T2QGBW-3210997-3210059
MMRRC Submission 041606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R3876 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6478322-6486941 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6481132 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 8 (A8V)
Ref Sequence ENSEMBL: ENSMUSP00000147586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086318] [ENSMUST00000207658] [ENSMUST00000209866] [ENSMUST00000215302]
Predicted Effect probably benign
Transcript: ENSMUST00000086318
AA Change: A8V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000083498
Gene: ENSMUSG00000096228
AA Change: A8V

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.1e-50 PFAM
Pfam:7tm_1 45 294 6.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207658
Predicted Effect probably benign
Transcript: ENSMUST00000209866
AA Change: A8V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000215302
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Chrnb4 T C 9: 55,043,898 E27G probably damaging Het
Clec14a A G 12: 58,268,644 V64A possibly damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Dpp10 T A 1: 123,353,487 Q611L probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fam184a C T 10: 53,699,061 V151I probably damaging Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 H971Q probably benign Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt34 T C 11: 100,040,965 T143A probably benign Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Oprk1 T A 1: 5,602,661 C340* probably null Het
Pald1 T A 10: 61,347,487 N323Y probably damaging Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Prl8a6 A T 13: 27,433,032 L225* probably null Het
Psme4 T C 11: 30,856,068 S89P probably damaging Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sept3 A T 15: 82,285,801 D32V probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Stxbp2 T C 8: 3,633,369 probably null Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Olfr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Olfr5 APN 7 6480998 missense probably benign
IGL02174:Olfr5 APN 7 6480439 missense probably benign
IGL03260:Olfr5 APN 7 6480659 missense probably damaging 0.99
IGL03411:Olfr5 APN 7 6480436 missense probably benign 0.26
R1186:Olfr5 UTSW 7 6480542 missense probably benign 0.00
R1381:Olfr5 UTSW 7 6481009 unclassified probably null
R1981:Olfr5 UTSW 7 6480932 missense probably benign 0.29
R1982:Olfr5 UTSW 7 6480932 missense probably benign 0.29
R3907:Olfr5 UTSW 7 6480679 missense probably damaging 1.00
R4422:Olfr5 UTSW 7 6481038 nonsense probably null
R4654:Olfr5 UTSW 7 6481046 missense probably benign 0.00
R5605:Olfr5 UTSW 7 6480326 missense probably benign 0.00
R6962:Olfr5 UTSW 7 6481009 missense probably benign 0.07
R7524:Olfr5 UTSW 7 6480587 missense probably benign 0.04
R7576:Olfr5 UTSW 7 6480331 missense probably damaging 0.97
Z1177:Olfr5 UTSW 7 6480873 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATAGCACATCTCCAGGCAGC -3'
(R):5'- ACCATGTATCACCAGGGAAAGAATG -3'

Sequencing Primer
(F):5'- ATCTCCAGGCAGCTGAGGTTG -3'
(R):5'- CCAGGGAAAGAATGTCAACAATTTTC -3'
Posted On2015-04-06