Mutagenetix > Incidental Mutation

Incidental Mutation 'R3876:Stxbp2'

276843

Institutional Source

Beutler Lab

Gene Symbol

Stxbp2

Ensembl Gene

ENSMUSG00000004626

Gene Name

syntaxin binding protein 2

Synonyms

muSec1, Munc18b, Munc-18-2, C79054, Sxtp2, Munc-18b

MMRRC Submission

041606-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3876 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3630955-3643644 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 3633369 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159888] [ENSMUST00000159911] [ENSMUST00000159911] [ENSMUST00000160708] [ENSMUST00000162867]

AlphaFold

Q64324

Predicted Effect

probably null
Transcript: ENSMUST00000004745

SMART Domains

Protein: ENSMUSP00000004745
Gene: ENSMUSG00000004626

Domain	Start	End	E-Value	Type
Pfam:Sec1	29	580	6.8e-113	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159888

Predicted Effect

probably null
Transcript: ENSMUST00000159911

Predicted Effect

probably null
Transcript: ENSMUST00000159911

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160435

Predicted Effect

probably null
Transcript: ENSMUST00000160708

SMART Domains

Protein: ENSMUSP00000125405
Gene: ENSMUSG00000004626

Domain	Start	End	E-Value	Type
Pfam:Sec1	29	579	4.9e-112	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161982

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162737

Predicted Effect

probably benign
Transcript: ENSMUST00000162867

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162974

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163044

Meta Mutation Damage Score

0.9592

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STXBP/unc-18/SEC1 family. The encoded protein is involved in intracellular trafficking, control of SNARE (soluble NSF attachment protein receptor) complex assembly, and the release of cytotoxic granules by natural killer cells. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality. Mice heterozygous for this allele exhibit decreased stimulated mucin secretion, release of histones in stimulated mast cells and decreased susceptibility to type I hypersensitivity reaction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	G	A	14: 54,591,400	R215*	probably null	Het
Brinp2	C	A	1: 158,246,846	L568F	probably damaging	Het
Brip1	T	C	11: 86,152,790	Y316C	probably damaging	Het
Cdk5rap2	ATGTG	ATG	4: 70,289,977		probably null	Het
Cfap69	G	T	5: 5,584,645		probably benign	Het
Chrnb4	T	C	9: 55,043,898	E27G	probably damaging	Het
Clec14a	A	G	12: 58,268,644	V64A	possibly damaging	Het
Crygs	A	G	16: 22,806,512	Y60H	probably damaging	Het
Dpp10	T	A	1: 123,353,487	Q611L	probably damaging	Het
Entpd1	T	C	19: 40,736,820	L450P	probably damaging	Het
Eogt	G	A	6: 97,120,190	S317L	probably damaging	Het
Exosc10	T	A	4: 148,572,919	S584T	probably benign	Het
Fam184a	C	T	10: 53,699,061	V151I	probably damaging	Het
Fbxo43	A	G	15: 36,152,112	V517A	probably damaging	Het
Flii	T	C	11: 60,719,872	T533A	possibly damaging	Het
Frmpd1	T	G	4: 45,284,093	H971Q	probably benign	Het
Gata3	A	T	2: 9,863,143	N333K	probably damaging	Het
Hectd1	A	G	12: 51,768,730	S1525P	probably damaging	Het
Ibtk	A	G	9: 85,718,426	I816T	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt34	T	C	11: 100,040,965	T143A	probably benign	Het
Lipn	G	T	19: 34,069,428	M43I	probably benign	Het
Lrp1b	A	G	2: 41,445,194	C779R	probably damaging	Het
Mios	G	A	6: 8,233,189	R779Q	probably damaging	Het
Mme	A	T	3: 63,362,059		probably benign	Het
Ncstn	A	G	1: 172,070,073	S418P	probably benign	Het
Olfr1209	T	C	2: 88,909,608	T262A	possibly damaging	Het
Olfr1285	T	C	2: 111,408,622	V69A	possibly damaging	Het
Olfr5	G	A	7: 6,481,132	A8V	probably benign	Het
Olfr800	C	T	10: 129,660,274	P156L	probably benign	Het
Olfr934	T	A	9: 38,982,870	Y58F	probably damaging	Het
Oprk1	T	A	1: 5,602,661	C340*	probably null	Het
Pald1	T	A	10: 61,347,487	N323Y	probably damaging	Het
Pcdhac1	C	A	18: 37,091,892	A586E	probably damaging	Het
Pcnx2	C	T	8: 125,888,158	A185T	probably benign	Het
Pik3r1	G	A	13: 101,684,957	H430Y	probably benign	Het
Polr3b	G	A	10: 84,720,518		probably null	Het
Prl8a6	A	T	13: 27,433,032	L225*	probably null	Het
Psme4	T	C	11: 30,856,068	S89P	probably damaging	Het
Pygl	G	A	12: 70,201,339	T250I	probably damaging	Het
Rgs13	T	A	1: 144,140,790	K72*	probably null	Het
Ryr2	T	A	13: 11,588,159	I4514F	probably damaging	Het
Sept3	A	T	15: 82,285,801	D32V	probably damaging	Het
Sfrp2	C	T	3: 83,767,028	P163S	possibly damaging	Het
Spata31	A	G	13: 64,920,931	T298A	probably benign	Het
Syne1	A	T	10: 5,052,345	M282K	possibly damaging	Het
Timd2	T	C	11: 46,671,020		probably null	Het
Tlr11	G	A	14: 50,363,154	V866I	probably benign	Het
Trappc10	T	C	10: 78,220,186		probably null	Het
Zfp512b	AG	AGG	2: 181,588,763		probably null	Het

Other mutations in Stxbp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Stxbp2	APN	8	3636354	critical splice acceptor site	probably null
IGL00466:Stxbp2	APN	8	3634065	missense	probably benign	0.29
IGL02315:Stxbp2	APN	8	3635607	unclassified	probably benign
IGL02508:Stxbp2	APN	8	3632531	missense	probably damaging	1.00
IGL02811:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02833:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02868:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02869:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02896:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02926:Stxbp2	APN	8	3635629	missense	probably benign	0.31
IGL02927:Stxbp2	APN	8	3642685	missense	possibly damaging	0.95
IGL02928:Stxbp2	APN	8	3641736	missense	probably damaging	0.99
IGL02943:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02945:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02948:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02951:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02972:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02976:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02977:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02983:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL02993:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL03008:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL03009:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL03038:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL03051:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL03061:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL03072:Stxbp2	APN	8	3641971	missense	probably benign	0.44
IGL03110:Stxbp2	APN	8	3633342	missense	probably damaging	1.00
IGL02988:Stxbp2	UTSW	8	3633267	intron	probably benign
R0463:Stxbp2	UTSW	8	3632559	missense	probably damaging	1.00
R0608:Stxbp2	UTSW	8	3632559	missense	probably damaging	1.00
R0755:Stxbp2	UTSW	8	3642019	missense	probably benign	0.01
R1328:Stxbp2	UTSW	8	3642657	missense	possibly damaging	0.56
R1771:Stxbp2	UTSW	8	3634064	missense	probably benign	0.01
R1962:Stxbp2	UTSW	8	3642672	missense	probably benign	0.00
R2195:Stxbp2	UTSW	8	3634615	splice site	probably null
R2319:Stxbp2	UTSW	8	3633834	missense	possibly damaging	0.95
R3614:Stxbp2	UTSW	8	3631196	missense	possibly damaging	0.94
R3870:Stxbp2	UTSW	8	3634079	missense	probably damaging	1.00
R4703:Stxbp2	UTSW	8	3632521	missense	probably damaging	1.00
R6533:Stxbp2	UTSW	8	3642683	missense	probably benign	0.01
R6623:Stxbp2	UTSW	8	3632561	missense	probably damaging	1.00
R6665:Stxbp2	UTSW	8	3641998	missense	probably benign	0.41
R6798:Stxbp2	UTSW	8	3641180	missense	probably benign
R7152:Stxbp2	UTSW	8	3632583	missense	probably benign	0.33
R7326:Stxbp2	UTSW	8	3641151	missense
R8237:Stxbp2	UTSW	8	3635695	missense
R8268:Stxbp2	UTSW	8	3632234	missense
R8709:Stxbp2	UTSW	8	3633914	missense	possibly damaging	0.50
R8811:Stxbp2	UTSW	8	3639541	missense
R9018:Stxbp2	UTSW	8	3642627	intron	probably benign
R9043:Stxbp2	UTSW	8	3634478	missense
R9048:Stxbp2	UTSW	8	3637218	missense
R9212:Stxbp2	UTSW	8	3636220	missense
R9421:Stxbp2	UTSW	8	3632264	missense
R9643:Stxbp2	UTSW	8	3636392	missense
Z1177:Stxbp2	UTSW	8	3641123	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCGAACCTTGACTGTAGCTCTTTAAG -3'
(R):5'- ACACATATACACTGGCATTTGC -3'

Sequencing Primer
(F):5'- ACTGTAGCTCTTTAAGTGGGGAAC -3'
(R):5'- TGGCATTTGCATACACATACACGG -3'

Posted On

2015-04-06