Incidental Mutation 'R3876:Stxbp2'
ID276843
Institutional Source Beutler Lab
Gene Symbol Stxbp2
Ensembl Gene ENSMUSG00000004626
Gene Namesyntaxin binding protein 2
SynonymsmuSec1, Munc18b, Munc-18-2, C79054, Sxtp2, Munc-18b
MMRRC Submission 041606-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3876 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3630955-3643644 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 3633369 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159888] [ENSMUST00000159911] [ENSMUST00000159911] [ENSMUST00000160708] [ENSMUST00000162867]
Predicted Effect probably null
Transcript: ENSMUST00000004745
SMART Domains Protein: ENSMUSP00000004745
Gene: ENSMUSG00000004626

DomainStartEndE-ValueType
Pfam:Sec1 29 580 6.8e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159888
Predicted Effect probably null
Transcript: ENSMUST00000159911
Predicted Effect probably null
Transcript: ENSMUST00000159911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160435
Predicted Effect probably null
Transcript: ENSMUST00000160708
SMART Domains Protein: ENSMUSP00000125405
Gene: ENSMUSG00000004626

DomainStartEndE-ValueType
Pfam:Sec1 29 579 4.9e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162737
Predicted Effect probably benign
Transcript: ENSMUST00000162867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163044
Meta Mutation Damage Score 0.9592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STXBP/unc-18/SEC1 family. The encoded protein is involved in intracellular trafficking, control of SNARE (soluble NSF attachment protein receptor) complex assembly, and the release of cytotoxic granules by natural killer cells. Mutations in this gene are associated with familial hemophagocytic lymphohistiocytosis. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality. Mice heterozygous for this allele exhibit decreased stimulated mucin secretion, release of histones in stimulated mast cells and decreased susceptibility to type I hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Chrnb4 T C 9: 55,043,898 E27G probably damaging Het
Clec14a A G 12: 58,268,644 V64A possibly damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Dpp10 T A 1: 123,353,487 Q611L probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fam184a C T 10: 53,699,061 V151I probably damaging Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 H971Q probably benign Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt34 T C 11: 100,040,965 T143A probably benign Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr5 G A 7: 6,481,132 A8V probably benign Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Oprk1 T A 1: 5,602,661 C340* probably null Het
Pald1 T A 10: 61,347,487 N323Y probably damaging Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Prl8a6 A T 13: 27,433,032 L225* probably null Het
Psme4 T C 11: 30,856,068 S89P probably damaging Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sept3 A T 15: 82,285,801 D32V probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Stxbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Stxbp2 APN 8 3636354 critical splice acceptor site probably null
IGL00466:Stxbp2 APN 8 3634065 missense probably benign 0.29
IGL02315:Stxbp2 APN 8 3635607 unclassified probably benign
IGL02508:Stxbp2 APN 8 3632531 missense probably damaging 1.00
IGL02811:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02833:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02868:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02869:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02896:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02926:Stxbp2 APN 8 3635629 missense probably benign 0.31
IGL02927:Stxbp2 APN 8 3642685 missense possibly damaging 0.95
IGL02928:Stxbp2 APN 8 3641736 missense probably damaging 0.99
IGL02943:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02945:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02948:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02951:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02972:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02976:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02977:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02983:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL02993:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03008:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03009:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03038:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03051:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03061:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03072:Stxbp2 APN 8 3641971 missense probably benign 0.44
IGL03110:Stxbp2 APN 8 3633342 missense probably damaging 1.00
IGL02988:Stxbp2 UTSW 8 3633267 intron probably benign
R0463:Stxbp2 UTSW 8 3632559 missense probably damaging 1.00
R0608:Stxbp2 UTSW 8 3632559 missense probably damaging 1.00
R0755:Stxbp2 UTSW 8 3642019 missense probably benign 0.01
R1328:Stxbp2 UTSW 8 3642657 missense possibly damaging 0.56
R1771:Stxbp2 UTSW 8 3634064 missense probably benign 0.01
R1962:Stxbp2 UTSW 8 3642672 missense probably benign 0.00
R2195:Stxbp2 UTSW 8 3634615 synonymous probably null
R2319:Stxbp2 UTSW 8 3633834 missense possibly damaging 0.95
R3614:Stxbp2 UTSW 8 3631196 missense possibly damaging 0.94
R3870:Stxbp2 UTSW 8 3634079 missense probably damaging 1.00
R4703:Stxbp2 UTSW 8 3632521 missense probably damaging 1.00
R6533:Stxbp2 UTSW 8 3642683 missense probably benign 0.01
R6623:Stxbp2 UTSW 8 3632561 missense probably damaging 1.00
R6665:Stxbp2 UTSW 8 3641998 missense probably benign 0.41
R6798:Stxbp2 UTSW 8 3641180 missense probably benign
R7152:Stxbp2 UTSW 8 3632583 missense probably benign 0.33
R7326:Stxbp2 UTSW 8 3641151 missense
Z1177:Stxbp2 UTSW 8 3641123 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGAACCTTGACTGTAGCTCTTTAAG -3'
(R):5'- ACACATATACACTGGCATTTGC -3'

Sequencing Primer
(F):5'- ACTGTAGCTCTTTAAGTGGGGAAC -3'
(R):5'- TGGCATTTGCATACACATACACGG -3'
Posted On2015-04-06