Incidental Mutation 'R3876:Chrnb4'
ID276846
Institutional Source Beutler Lab
Gene Symbol Chrnb4
Ensembl Gene ENSMUSG00000035200
Gene Namecholinergic receptor, nicotinic, beta polypeptide 4
SynonymsAcrb-4, Acrb4
MMRRC Submission 041606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3876 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location55028154-55048779 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55043898 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 27 (E27G)
Ref Sequence ENSEMBL: ENSMUSP00000034854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034854]
Predicted Effect probably damaging
Transcript: ENSMUST00000034854
AA Change: E27G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034854
Gene: ENSMUSG00000035200
AA Change: E27G

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 231 3.2e-70 PFAM
Pfam:Neur_chan_memb 238 481 6.1e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217609
Meta Mutation Damage Score 0.2264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in hyperplasia of the bladder and altered bladder contractility. Mutant mice also exhibit a resistance to nicotine-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Clec14a A G 12: 58,268,644 V64A possibly damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Dpp10 T A 1: 123,353,487 Q611L probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fam184a C T 10: 53,699,061 V151I probably damaging Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 H971Q probably benign Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt34 T C 11: 100,040,965 T143A probably benign Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr5 G A 7: 6,481,132 A8V probably benign Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Oprk1 T A 1: 5,602,661 C340* probably null Het
Pald1 T A 10: 61,347,487 N323Y probably damaging Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Prl8a6 A T 13: 27,433,032 L225* probably null Het
Psme4 T C 11: 30,856,068 S89P probably damaging Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sept3 A T 15: 82,285,801 D32V probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Stxbp2 T C 8: 3,633,369 probably null Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Chrnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Chrnb4 APN 9 55036594 missense probably damaging 1.00
IGL02207:Chrnb4 APN 9 55035216 missense probably damaging 1.00
IGL03242:Chrnb4 APN 9 55035528 missense probably damaging 1.00
R0345:Chrnb4 UTSW 9 55035594 missense probably benign
R0735:Chrnb4 UTSW 9 55043800 missense probably damaging 0.96
R1843:Chrnb4 UTSW 9 55034818 missense possibly damaging 0.93
R1975:Chrnb4 UTSW 9 55034818 missense probably damaging 0.99
R2204:Chrnb4 UTSW 9 55043848 missense probably damaging 1.00
R2427:Chrnb4 UTSW 9 55034817 missense probably benign 0.00
R4934:Chrnb4 UTSW 9 55034817 missense probably benign 0.00
R5094:Chrnb4 UTSW 9 55035313 missense probably benign 0.00
R5507:Chrnb4 UTSW 9 55035012 missense probably damaging 1.00
R6370:Chrnb4 UTSW 9 55034859 missense probably benign 0.00
R7556:Chrnb4 UTSW 9 55035055 missense probably benign 0.19
R8399:Chrnb4 UTSW 9 55043823 missense probably benign 0.02
X0062:Chrnb4 UTSW 9 55034680 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTCTCCCCAAAGAGTCCTG -3'
(R):5'- ACACAGACAAGCCTGTTGG -3'

Sequencing Primer
(F):5'- AAGAGTCCTGCCTCTTCTCCTAAG -3'
(R):5'- TAGCTCCACCCACTGCAAGTC -3'
Posted On2015-04-06