Incidental Mutation 'R3876:Fam184a'
ID276849
Institutional Source Beutler Lab
Gene Symbol Fam184a
Ensembl Gene ENSMUSG00000019856
Gene Namefamily with sequence similarity 184, member A
Synonyms4930438C08Rik, 4930589M24Rik, 3110012E06Rik
MMRRC Submission 041606-MU
Accession Numbers

Genbank: NM_001081428; MGI: 1923156

Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R3876 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location53633145-53751123 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53699061 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 151 (V151I)
Ref Sequence ENSEMBL: ENSMUSP00000020003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020003] [ENSMUST00000163761] [ENSMUST00000171807]
Predicted Effect probably damaging
Transcript: ENSMUST00000020003
AA Change: V151I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020003
Gene: ENSMUSG00000019856
AA Change: V151I

DomainStartEndE-ValueType
Pfam:FAM184 57 267 1.5e-84 PFAM
low complexity region 436 449 N/A INTRINSIC
Blast:HisKA 533 598 4e-6 BLAST
coiled coil region 656 788 N/A INTRINSIC
internal_repeat_2 795 864 2.49e-6 PROSPERO
internal_repeat_1 800 866 4.75e-7 PROSPERO
coiled coil region 960 983 N/A INTRINSIC
low complexity region 1101 1113 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163761
AA Change: V95I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127400
Gene: ENSMUSG00000019856
AA Change: V95I

DomainStartEndE-ValueType
coiled coil region 4 88 N/A INTRINSIC
internal_repeat_1 99 167 6.86e-8 PROSPERO
internal_repeat_2 105 173 4e-7 PROSPERO
low complexity region 380 393 N/A INTRINSIC
Blast:HisKA 480 542 5e-6 BLAST
coiled coil region 600 732 N/A INTRINSIC
internal_repeat_2 739 808 4e-7 PROSPERO
internal_repeat_1 744 810 6.86e-8 PROSPERO
low complexity region 906 916 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170839
Predicted Effect probably benign
Transcript: ENSMUST00000171807
SMART Domains Protein: ENSMUSP00000130315
Gene: ENSMUSG00000019856

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
Pfam:DUF3090 64 159 5.9e-8 PFAM
low complexity region 303 343 N/A INTRINSIC
low complexity region 358 364 N/A INTRINSIC
internal_repeat_1 383 410 4.35e-5 PROSPERO
internal_repeat_1 424 451 4.35e-5 PROSPERO
low complexity region 648 660 N/A INTRINSIC
Meta Mutation Damage Score 0.1658 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Chrnb4 T C 9: 55,043,898 E27G probably damaging Het
Clec14a A G 12: 58,268,644 V64A possibly damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Dpp10 T A 1: 123,353,487 Q611L probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 H971Q probably benign Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt34 T C 11: 100,040,965 T143A probably benign Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr5 G A 7: 6,481,132 A8V probably benign Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Oprk1 T A 1: 5,602,661 C340* probably null Het
Pald1 T A 10: 61,347,487 N323Y probably damaging Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Prl8a6 A T 13: 27,433,032 L225* probably null Het
Psme4 T C 11: 30,856,068 S89P probably damaging Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sept3 A T 15: 82,285,801 D32V probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Stxbp2 T C 8: 3,633,369 probably null Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Fam184a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Fam184a APN 10 53694686 splice site probably benign
IGL01448:Fam184a APN 10 53698949 missense probably benign 0.19
IGL02052:Fam184a APN 10 53697120 unclassified probably benign
IGL02086:Fam184a APN 10 53699255 missense probably damaging 1.00
IGL02163:Fam184a APN 10 53647134 splice site probably null
IGL02247:Fam184a APN 10 53675160 missense probably damaging 1.00
IGL02316:Fam184a APN 10 53638239 missense probably damaging 1.00
IGL02493:Fam184a APN 10 53694693 critical splice donor site probably null
IGL02629:Fam184a APN 10 53698811 missense possibly damaging 0.80
IGL03006:Fam184a APN 10 53698697 missense probably damaging 1.00
2107:Fam184a UTSW 10 53641057 missense probably damaging 1.00
PIT4802001:Fam184a UTSW 10 53684354 nonsense probably null
R0427:Fam184a UTSW 10 53690115 missense probably damaging 1.00
R0477:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R0511:Fam184a UTSW 10 53698879 missense probably benign 0.03
R1322:Fam184a UTSW 10 53652319 missense probably damaging 1.00
R1422:Fam184a UTSW 10 53675208 missense probably benign 0.29
R1474:Fam184a UTSW 10 53635365 missense probably damaging 0.99
R1752:Fam184a UTSW 10 53674570 missense probably benign 0.02
R1831:Fam184a UTSW 10 53647084 missense probably damaging 0.97
R2186:Fam184a UTSW 10 53638194 missense probably damaging 1.00
R2202:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2203:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2221:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2223:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2261:Fam184a UTSW 10 53647570 critical splice donor site probably null
R2444:Fam184a UTSW 10 53640949 missense probably damaging 1.00
R3932:Fam184a UTSW 10 53699301 missense probably damaging 0.99
R4685:Fam184a UTSW 10 53698500 missense probably benign 0.39
R4953:Fam184a UTSW 10 53698805 missense probably benign 0.00
R5056:Fam184a UTSW 10 53674574 missense probably damaging 1.00
R5420:Fam184a UTSW 10 53633657 missense probably damaging 0.99
R6159:Fam184a UTSW 10 53698773 missense probably damaging 1.00
R6554:Fam184a UTSW 10 53640967 missense possibly damaging 0.95
R6714:Fam184a UTSW 10 53698883 missense probably benign 0.00
R6966:Fam184a UTSW 10 53654999 missense probably benign 0.34
R7034:Fam184a UTSW 10 53694814 missense possibly damaging 0.71
R7237:Fam184a UTSW 10 53634393 unclassified probably benign
R7253:Fam184a UTSW 10 53698805 missense probably benign 0.00
R7359:Fam184a UTSW 10 53699222 missense probably damaging 1.00
R7449:Fam184a UTSW 10 53698634 missense probably damaging 0.98
R7479:Fam184a UTSW 10 53655014 missense probably benign 0.01
R7725:Fam184a UTSW 10 53633706 nonsense probably null
R7726:Fam184a UTSW 10 53633706 nonsense probably null
R7881:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7886:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7896:Fam184a UTSW 10 53633706 nonsense probably null
R7897:Fam184a UTSW 10 53633706 nonsense probably null
R7964:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7969:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7979:Fam184a UTSW 10 53633706 nonsense probably null
R7980:Fam184a UTSW 10 53633706 nonsense probably null
R8049:Fam184a UTSW 10 53633706 nonsense probably null
Z1177:Fam184a UTSW 10 53699086 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGACTTCAACAGCTCTTGGACTTC -3'
(R):5'- TTCAGGCCCTCAAAGATGCC -3'

Sequencing Primer
(F):5'- AACAGCTCTTGGACTTCGAGCC -3'
(R):5'- GCCCTCAAAGATGCCCATGAAG -3'
Posted On2015-04-06