Incidental Mutation 'R3876:Psme4'
ID 276854
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 041606-MU
Accession Numbers

Genbank: NM_134013

Essential gene? Non essential (E-score: 0.000) question?
Stock # R3876 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 30771726-30880361 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30856068 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 89 (S89P)
Ref Sequence ENSEMBL: ENSMUSP00000114537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231] [ENSMUST00000129824]
AlphaFold Q5SSW2
Predicted Effect possibly damaging
Transcript: ENSMUST00000041231
AA Change: S1590P

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: S1590P

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129824
AA Change: S89P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.1461 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Chrnb4 T C 9: 55,043,898 E27G probably damaging Het
Clec14a A G 12: 58,268,644 V64A possibly damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Dpp10 T A 1: 123,353,487 Q611L probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fam184a C T 10: 53,699,061 V151I probably damaging Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 H971Q probably benign Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt34 T C 11: 100,040,965 T143A probably benign Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr5 G A 7: 6,481,132 A8V probably benign Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Oprk1 T A 1: 5,602,661 C340* probably null Het
Pald1 T A 10: 61,347,487 N323Y probably damaging Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Prl8a6 A T 13: 27,433,032 L225* probably null Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sept3 A T 15: 82,285,801 D32V probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Stxbp2 T C 8: 3,633,369 probably null Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 splice site probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 splice site probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 splice site probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 splice site probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
R8130:Psme4 UTSW 11 30842026 missense probably damaging 1.00
R8323:Psme4 UTSW 11 30843532 missense probably damaging 0.99
R8330:Psme4 UTSW 11 30843583 missense probably benign 0.00
R8363:Psme4 UTSW 11 30812139 missense probably damaging 1.00
R8491:Psme4 UTSW 11 30772161 missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30837319 missense probably benign 0.00
R8696:Psme4 UTSW 11 30809896 missense probably damaging 0.99
R8743:Psme4 UTSW 11 30878467 missense probably damaging 1.00
R8998:Psme4 UTSW 11 30838957 missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30865576 missense probably damaging 1.00
R9657:Psme4 UTSW 11 30838980 missense probably benign 0.00
R9736:Psme4 UTSW 11 30847411 missense probably damaging 0.99
R9744:Psme4 UTSW 11 30815294 critical splice donor site probably null
R9746:Psme4 UTSW 11 30876868 nonsense probably null
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGGCAGGCTATTATAACTCGTAG -3'
(R):5'- CCCTATCTTGAATGATATGGATTGC -3'

Sequencing Primer
(F):5'- ACCCTCAATTACTTGATTACCATGG -3'
(R):5'- ATGGATTGCTTTAAAAGTGGATTAGG -3'
Posted On 2015-04-06