Incidental Mutation 'R3876:Psme4'
ID 276854
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 041606-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3876 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 30721726-30830361 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30806068 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 89 (S89P)
Ref Sequence ENSEMBL: ENSMUSP00000114537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231] [ENSMUST00000129824]
AlphaFold Q5SSW2
Predicted Effect possibly damaging
Transcript: ENSMUST00000041231
AA Change: S1590P

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: S1590P

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129824
AA Change: S89P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.1461 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,828,857 (GRCm39) R215* probably null Het
Brinp2 C A 1: 158,074,416 (GRCm39) L568F probably damaging Het
Brip1 T C 11: 86,043,616 (GRCm39) Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,208,214 (GRCm39) probably null Het
Cfap69 G T 5: 5,634,645 (GRCm39) probably benign Het
Chrnb4 T C 9: 54,951,182 (GRCm39) E27G probably damaging Het
Clec14a A G 12: 58,315,430 (GRCm39) V64A possibly damaging Het
Crygs A G 16: 22,625,262 (GRCm39) Y60H probably damaging Het
Dpp10 T A 1: 123,281,216 (GRCm39) Q611L probably damaging Het
Entpd1 T C 19: 40,725,264 (GRCm39) L450P probably damaging Het
Eogt G A 6: 97,097,151 (GRCm39) S317L probably damaging Het
Exosc10 T A 4: 148,657,376 (GRCm39) S584T probably benign Het
Fam184a C T 10: 53,575,157 (GRCm39) V151I probably damaging Het
Fbxo43 A G 15: 36,152,258 (GRCm39) V517A probably damaging Het
Flii T C 11: 60,610,698 (GRCm39) T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 (GRCm39) H971Q probably benign Het
Gata3 A T 2: 9,867,954 (GRCm39) N333K probably damaging Het
Hectd1 A G 12: 51,815,513 (GRCm39) S1525P probably damaging Het
Ibtk A G 9: 85,600,479 (GRCm39) I816T probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt34 T C 11: 99,931,791 (GRCm39) T143A probably benign Het
Lipn G T 19: 34,046,828 (GRCm39) M43I probably benign Het
Lrp1b A G 2: 41,335,206 (GRCm39) C779R probably damaging Het
Mios G A 6: 8,233,189 (GRCm39) R779Q probably damaging Het
Mme A T 3: 63,269,480 (GRCm39) probably benign Het
Ncstn A G 1: 171,897,640 (GRCm39) S418P probably benign Het
Oprk1 T A 1: 5,672,884 (GRCm39) C340* probably null Het
Or10d1c T A 9: 38,894,166 (GRCm39) Y58F probably damaging Het
Or4c29 T C 2: 88,739,952 (GRCm39) T262A possibly damaging Het
Or4k39 T C 2: 111,238,967 (GRCm39) V69A possibly damaging Het
Or6c210 C T 10: 129,496,143 (GRCm39) P156L probably benign Het
Or6z7 G A 7: 6,484,131 (GRCm39) A8V probably benign Het
Pald1 T A 10: 61,183,266 (GRCm39) N323Y probably damaging Het
Pcdhac1 C A 18: 37,224,945 (GRCm39) A586E probably damaging Het
Pcnx2 C T 8: 126,614,897 (GRCm39) A185T probably benign Het
Pik3r1 G A 13: 101,821,465 (GRCm39) H430Y probably benign Het
Polr3b G A 10: 84,556,382 (GRCm39) probably null Het
Prl8a6 A T 13: 27,617,015 (GRCm39) L225* probably null Het
Pygl G A 12: 70,248,113 (GRCm39) T250I probably damaging Het
Rgs13 T A 1: 144,016,528 (GRCm39) K72* probably null Het
Ryr2 T A 13: 11,603,045 (GRCm39) I4514F probably damaging Het
Septin3 A T 15: 82,170,002 (GRCm39) D32V probably damaging Het
Sfrp2 C T 3: 83,674,335 (GRCm39) P163S possibly damaging Het
Spata31 A G 13: 65,068,745 (GRCm39) T298A probably benign Het
Stxbp2 T C 8: 3,683,369 (GRCm39) probably null Het
Syne1 A T 10: 5,002,345 (GRCm39) M282K possibly damaging Het
Timd2 T C 11: 46,561,847 (GRCm39) probably null Het
Tlr11 G A 14: 50,600,611 (GRCm39) V866I probably benign Het
Trappc10 T C 10: 78,056,020 (GRCm39) probably null Het
Zfp512b AG AGG 2: 181,230,556 (GRCm39) probably null Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30,765,710 (GRCm39) critical splice donor site probably null
IGL00401:Psme4 APN 11 30,771,079 (GRCm39) splice site probably benign
IGL00475:Psme4 APN 11 30,795,252 (GRCm39) missense probably benign 0.14
IGL00576:Psme4 APN 11 30,773,145 (GRCm39) missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30,770,129 (GRCm39) missense probably benign 0.01
IGL01525:Psme4 APN 11 30,759,936 (GRCm39) splice site probably benign
IGL01862:Psme4 APN 11 30,762,038 (GRCm39) nonsense probably null
IGL02310:Psme4 APN 11 30,787,484 (GRCm39) missense probably benign 0.06
IGL02477:Psme4 APN 11 30,792,083 (GRCm39) missense probably damaging 0.99
IGL02545:Psme4 APN 11 30,791,586 (GRCm39) missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30,770,944 (GRCm39) missense probably benign 0.34
IGL02621:Psme4 APN 11 30,798,131 (GRCm39) missense probably benign
IGL02822:Psme4 APN 11 30,798,204 (GRCm39) unclassified probably benign
IGL02833:Psme4 APN 11 30,800,715 (GRCm39) unclassified probably benign
IGL02964:Psme4 APN 11 30,741,095 (GRCm39) nonsense probably null
IGL03273:Psme4 APN 11 30,798,130 (GRCm39) missense probably damaging 1.00
IGL03348:Psme4 APN 11 30,826,796 (GRCm39) missense probably damaging 1.00
IGL03382:Psme4 APN 11 30,757,788 (GRCm39) missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30,771,079 (GRCm39) splice site probably benign
R0276:Psme4 UTSW 11 30,761,980 (GRCm39) missense probably damaging 1.00
R0462:Psme4 UTSW 11 30,798,117 (GRCm39) missense probably damaging 1.00
R0685:Psme4 UTSW 11 30,828,415 (GRCm39) missense probably damaging 1.00
R0766:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R0830:Psme4 UTSW 11 30,757,797 (GRCm39) missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30,765,264 (GRCm39) missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30,754,310 (GRCm39) missense probably damaging 1.00
R1312:Psme4 UTSW 11 30,757,687 (GRCm39) splice site probably null
R1448:Psme4 UTSW 11 30,802,744 (GRCm39) missense probably damaging 1.00
R1713:Psme4 UTSW 11 30,756,310 (GRCm39) missense probably damaging 1.00
R1732:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R1813:Psme4 UTSW 11 30,754,353 (GRCm39) missense probably benign 0.14
R1905:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1907:Psme4 UTSW 11 30,760,922 (GRCm39) missense probably damaging 1.00
R1911:Psme4 UTSW 11 30,765,658 (GRCm39) missense probably benign 0.02
R1956:Psme4 UTSW 11 30,782,424 (GRCm39) missense probably damaging 0.99
R1974:Psme4 UTSW 11 30,769,011 (GRCm39) missense probably benign 0.00
R1980:Psme4 UTSW 11 30,782,615 (GRCm39) missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30,780,352 (GRCm39) missense probably benign 0.01
R2046:Psme4 UTSW 11 30,767,723 (GRCm39) splice site probably benign
R2142:Psme4 UTSW 11 30,770,998 (GRCm39) missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30,824,282 (GRCm39) critical splice donor site probably null
R2844:Psme4 UTSW 11 30,795,173 (GRCm39) splice site probably benign
R3807:Psme4 UTSW 11 30,806,027 (GRCm39) splice site probably null
R4420:Psme4 UTSW 11 30,762,028 (GRCm39) missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30,784,318 (GRCm39) missense probably damaging 1.00
R4615:Psme4 UTSW 11 30,784,287 (GRCm39) missense probably benign 0.02
R4714:Psme4 UTSW 11 30,782,573 (GRCm39) missense probably benign 0.02
R5008:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R5109:Psme4 UTSW 11 30,741,095 (GRCm39) nonsense probably null
R5155:Psme4 UTSW 11 30,826,806 (GRCm39) missense probably damaging 1.00
R5199:Psme4 UTSW 11 30,803,272 (GRCm39) missense probably benign 0.00
R5205:Psme4 UTSW 11 30,782,666 (GRCm39) intron probably benign
R5452:Psme4 UTSW 11 30,741,168 (GRCm39) missense probably benign
R5491:Psme4 UTSW 11 30,765,246 (GRCm39) missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30,759,837 (GRCm39) missense probably damaging 0.99
R5764:Psme4 UTSW 11 30,722,364 (GRCm39) intron probably benign
R5853:Psme4 UTSW 11 30,741,234 (GRCm39) critical splice donor site probably null
R5865:Psme4 UTSW 11 30,741,993 (GRCm39) missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30,791,589 (GRCm39) missense probably benign 0.28
R5927:Psme4 UTSW 11 30,754,294 (GRCm39) missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30,806,896 (GRCm39) intron probably benign
R6102:Psme4 UTSW 11 30,815,567 (GRCm39) missense probably damaging 1.00
R6247:Psme4 UTSW 11 30,803,245 (GRCm39) missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30,782,175 (GRCm39) missense probably benign
R6750:Psme4 UTSW 11 30,803,203 (GRCm39) missense probably damaging 1.00
R6885:Psme4 UTSW 11 30,784,307 (GRCm39) nonsense probably null
R6939:Psme4 UTSW 11 30,787,291 (GRCm39) missense probably damaging 0.99
R6945:Psme4 UTSW 11 30,787,437 (GRCm39) missense probably benign 0.06
R7029:Psme4 UTSW 11 30,722,474 (GRCm39) intron probably benign
R7049:Psme4 UTSW 11 30,763,904 (GRCm39) splice site probably null
R7098:Psme4 UTSW 11 30,800,661 (GRCm39) missense probably damaging 0.99
R7107:Psme4 UTSW 11 30,798,105 (GRCm39) missense probably benign 0.03
R7223:Psme4 UTSW 11 30,824,226 (GRCm39) missense probably benign 0.33
R7319:Psme4 UTSW 11 30,757,790 (GRCm39) missense probably benign 0.00
R7375:Psme4 UTSW 11 30,722,700 (GRCm39) splice site probably null
R7410:Psme4 UTSW 11 30,765,279 (GRCm39) nonsense probably null
R7469:Psme4 UTSW 11 30,752,837 (GRCm39) missense probably benign 0.20
R7651:Psme4 UTSW 11 30,787,334 (GRCm39) missense probably damaging 0.98
R7679:Psme4 UTSW 11 30,828,425 (GRCm39) missense probably damaging 0.99
R7681:Psme4 UTSW 11 30,741,975 (GRCm39) missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30,824,245 (GRCm39) missense probably benign
R8013:Psme4 UTSW 11 30,754,320 (GRCm39) missense probably benign 0.06
R8130:Psme4 UTSW 11 30,792,026 (GRCm39) missense probably damaging 1.00
R8323:Psme4 UTSW 11 30,793,532 (GRCm39) missense probably damaging 0.99
R8330:Psme4 UTSW 11 30,793,583 (GRCm39) missense probably benign 0.00
R8363:Psme4 UTSW 11 30,762,139 (GRCm39) missense probably damaging 1.00
R8491:Psme4 UTSW 11 30,722,161 (GRCm39) missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30,787,319 (GRCm39) missense probably benign 0.00
R8696:Psme4 UTSW 11 30,759,896 (GRCm39) missense probably damaging 0.99
R8743:Psme4 UTSW 11 30,828,467 (GRCm39) missense probably damaging 1.00
R8998:Psme4 UTSW 11 30,788,957 (GRCm39) missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30,815,576 (GRCm39) missense probably damaging 1.00
R9657:Psme4 UTSW 11 30,788,980 (GRCm39) missense probably benign 0.00
R9736:Psme4 UTSW 11 30,797,411 (GRCm39) missense probably damaging 0.99
R9744:Psme4 UTSW 11 30,765,294 (GRCm39) critical splice donor site probably null
R9746:Psme4 UTSW 11 30,826,868 (GRCm39) nonsense probably null
V5088:Psme4 UTSW 11 30,801,210 (GRCm39) missense probably benign 0.17
X0063:Psme4 UTSW 11 30,782,600 (GRCm39) missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30,793,522 (GRCm39) missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30,762,138 (GRCm39) missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30,756,311 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGGCAGGCTATTATAACTCGTAG -3'
(R):5'- CCCTATCTTGAATGATATGGATTGC -3'

Sequencing Primer
(F):5'- ACCCTCAATTACTTGATTACCATGG -3'
(R):5'- ATGGATTGCTTTAAAAGTGGATTAGG -3'
Posted On 2015-04-06