Incidental Mutation 'R3876:Krt34'
ID276858
Institutional Source Beutler Lab
Gene Symbol Krt34
Ensembl Gene ENSMUSG00000043485
Gene Namekeratin 34
SynonymsKrt1-4, 4733401E01Rik
MMRRC Submission 041606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3876 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100037347-100041554 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100040965 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 143 (T143A)
Ref Sequence ENSEMBL: ENSMUSP00000056622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056362]
Predicted Effect probably benign
Transcript: ENSMUST00000056362
AA Change: T143A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000056622
Gene: ENSMUSG00000043485
AA Change: T143A

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 7.76e-151 SMART
low complexity region 378 392 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Chrnb4 T C 9: 55,043,898 E27G probably damaging Het
Clec14a A G 12: 58,268,644 V64A possibly damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Dpp10 T A 1: 123,353,487 Q611L probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fam184a C T 10: 53,699,061 V151I probably damaging Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 H971Q probably benign Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr5 G A 7: 6,481,132 A8V probably benign Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Oprk1 T A 1: 5,602,661 C340* probably null Het
Pald1 T A 10: 61,347,487 N323Y probably damaging Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Prl8a6 A T 13: 27,433,032 L225* probably null Het
Psme4 T C 11: 30,856,068 S89P probably damaging Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sept3 A T 15: 82,285,801 D32V probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Stxbp2 T C 8: 3,633,369 probably null Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Krt34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Krt34 APN 11 100038694 splice site probably benign
IGL01323:Krt34 APN 11 100038780 missense possibly damaging 0.95
IGL01403:Krt34 APN 11 100038290 missense possibly damaging 0.88
IGL01453:Krt34 APN 11 100040090 missense probably damaging 1.00
IGL02031:Krt34 APN 11 100039023 missense possibly damaging 0.95
IGL02831:Krt34 APN 11 100040147 splice site probably benign
R0024:Krt34 UTSW 11 100041037 missense probably benign 0.01
R0024:Krt34 UTSW 11 100041037 missense probably benign 0.01
R0220:Krt34 UTSW 11 100038693 splice site probably benign
R0242:Krt34 UTSW 11 100041331 missense probably damaging 1.00
R1573:Krt34 UTSW 11 100041028 missense probably benign 0.01
R1714:Krt34 UTSW 11 100040127 missense possibly damaging 0.95
R1879:Krt34 UTSW 11 100038292 missense possibly damaging 0.76
R3084:Krt34 UTSW 11 100041021 missense probably damaging 1.00
R3692:Krt34 UTSW 11 100039031 missense probably damaging 1.00
R3819:Krt34 UTSW 11 100040018 missense probably damaging 1.00
R3872:Krt34 UTSW 11 100041417 missense probably benign
R6164:Krt34 UTSW 11 100038446 nonsense probably null
R6338:Krt34 UTSW 11 100038490 missense probably benign 0.00
R6457:Krt34 UTSW 11 100040090 missense probably damaging 1.00
R7728:Krt34 UTSW 11 100039985 critical splice donor site probably null
R7748:Krt34 UTSW 11 100038938 missense probably damaging 1.00
R7903:Krt34 UTSW 11 100041495 start codon destroyed probably null 0.42
R7986:Krt34 UTSW 11 100041495 start codon destroyed probably null 0.42
Z1176:Krt34 UTSW 11 100041434 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTAGGGTCTGAATACCTATTTG -3'
(R):5'- TCAGGACCATTGAGGAGCTG -3'

Sequencing Primer
(F):5'- CACACTCAGGAGAAGACATG -3'
(R):5'- TGAGAGGGTAGCCTATCTCAG -3'
Posted On2015-04-06