Incidental Mutation 'R3876:Krt34'
ID 276858
Institutional Source Beutler Lab
Gene Symbol Krt34
Ensembl Gene ENSMUSG00000043485
Gene Name keratin 34
Synonyms 4733401E01Rik, Krt1-4
MMRRC Submission 041606-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R3876 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 99928173-99932380 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99931791 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 143 (T143A)
Ref Sequence ENSEMBL: ENSMUSP00000056622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056362]
AlphaFold Q9D646
Predicted Effect probably benign
Transcript: ENSMUST00000056362
AA Change: T143A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000056622
Gene: ENSMUSG00000043485
AA Change: T143A

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 7.76e-151 SMART
low complexity region 378 392 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,828,857 (GRCm39) R215* probably null Het
Brinp2 C A 1: 158,074,416 (GRCm39) L568F probably damaging Het
Brip1 T C 11: 86,043,616 (GRCm39) Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,208,214 (GRCm39) probably null Het
Cfap69 G T 5: 5,634,645 (GRCm39) probably benign Het
Chrnb4 T C 9: 54,951,182 (GRCm39) E27G probably damaging Het
Clec14a A G 12: 58,315,430 (GRCm39) V64A possibly damaging Het
Crygs A G 16: 22,625,262 (GRCm39) Y60H probably damaging Het
Dpp10 T A 1: 123,281,216 (GRCm39) Q611L probably damaging Het
Entpd1 T C 19: 40,725,264 (GRCm39) L450P probably damaging Het
Eogt G A 6: 97,097,151 (GRCm39) S317L probably damaging Het
Exosc10 T A 4: 148,657,376 (GRCm39) S584T probably benign Het
Fam184a C T 10: 53,575,157 (GRCm39) V151I probably damaging Het
Fbxo43 A G 15: 36,152,258 (GRCm39) V517A probably damaging Het
Flii T C 11: 60,610,698 (GRCm39) T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 (GRCm39) H971Q probably benign Het
Gata3 A T 2: 9,867,954 (GRCm39) N333K probably damaging Het
Hectd1 A G 12: 51,815,513 (GRCm39) S1525P probably damaging Het
Ibtk A G 9: 85,600,479 (GRCm39) I816T probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lipn G T 19: 34,046,828 (GRCm39) M43I probably benign Het
Lrp1b A G 2: 41,335,206 (GRCm39) C779R probably damaging Het
Mios G A 6: 8,233,189 (GRCm39) R779Q probably damaging Het
Mme A T 3: 63,269,480 (GRCm39) probably benign Het
Ncstn A G 1: 171,897,640 (GRCm39) S418P probably benign Het
Oprk1 T A 1: 5,672,884 (GRCm39) C340* probably null Het
Or10d1c T A 9: 38,894,166 (GRCm39) Y58F probably damaging Het
Or4c29 T C 2: 88,739,952 (GRCm39) T262A possibly damaging Het
Or4k39 T C 2: 111,238,967 (GRCm39) V69A possibly damaging Het
Or6c210 C T 10: 129,496,143 (GRCm39) P156L probably benign Het
Or6z7 G A 7: 6,484,131 (GRCm39) A8V probably benign Het
Pald1 T A 10: 61,183,266 (GRCm39) N323Y probably damaging Het
Pcdhac1 C A 18: 37,224,945 (GRCm39) A586E probably damaging Het
Pcnx2 C T 8: 126,614,897 (GRCm39) A185T probably benign Het
Pik3r1 G A 13: 101,821,465 (GRCm39) H430Y probably benign Het
Polr3b G A 10: 84,556,382 (GRCm39) probably null Het
Prl8a6 A T 13: 27,617,015 (GRCm39) L225* probably null Het
Psme4 T C 11: 30,806,068 (GRCm39) S89P probably damaging Het
Pygl G A 12: 70,248,113 (GRCm39) T250I probably damaging Het
Rgs13 T A 1: 144,016,528 (GRCm39) K72* probably null Het
Ryr2 T A 13: 11,603,045 (GRCm39) I4514F probably damaging Het
Septin3 A T 15: 82,170,002 (GRCm39) D32V probably damaging Het
Sfrp2 C T 3: 83,674,335 (GRCm39) P163S possibly damaging Het
Spata31 A G 13: 65,068,745 (GRCm39) T298A probably benign Het
Stxbp2 T C 8: 3,683,369 (GRCm39) probably null Het
Syne1 A T 10: 5,002,345 (GRCm39) M282K possibly damaging Het
Timd2 T C 11: 46,561,847 (GRCm39) probably null Het
Tlr11 G A 14: 50,600,611 (GRCm39) V866I probably benign Het
Trappc10 T C 10: 78,056,020 (GRCm39) probably null Het
Zfp512b AG AGG 2: 181,230,556 (GRCm39) probably null Het
Other mutations in Krt34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Krt34 APN 11 99,929,520 (GRCm39) splice site probably benign
IGL01323:Krt34 APN 11 99,929,606 (GRCm39) missense possibly damaging 0.95
IGL01403:Krt34 APN 11 99,929,116 (GRCm39) missense possibly damaging 0.88
IGL01453:Krt34 APN 11 99,930,916 (GRCm39) missense probably damaging 1.00
IGL02031:Krt34 APN 11 99,929,849 (GRCm39) missense possibly damaging 0.95
IGL02831:Krt34 APN 11 99,930,973 (GRCm39) splice site probably benign
R0024:Krt34 UTSW 11 99,931,863 (GRCm39) missense probably benign 0.01
R0024:Krt34 UTSW 11 99,931,863 (GRCm39) missense probably benign 0.01
R0220:Krt34 UTSW 11 99,929,519 (GRCm39) splice site probably benign
R0242:Krt34 UTSW 11 99,932,157 (GRCm39) missense probably damaging 1.00
R1573:Krt34 UTSW 11 99,931,854 (GRCm39) missense probably benign 0.01
R1714:Krt34 UTSW 11 99,930,953 (GRCm39) missense possibly damaging 0.95
R1879:Krt34 UTSW 11 99,929,118 (GRCm39) missense possibly damaging 0.76
R3084:Krt34 UTSW 11 99,931,847 (GRCm39) missense probably damaging 1.00
R3692:Krt34 UTSW 11 99,929,857 (GRCm39) missense probably damaging 1.00
R3819:Krt34 UTSW 11 99,930,844 (GRCm39) missense probably damaging 1.00
R3872:Krt34 UTSW 11 99,932,243 (GRCm39) missense probably benign
R6164:Krt34 UTSW 11 99,929,272 (GRCm39) nonsense probably null
R6338:Krt34 UTSW 11 99,929,316 (GRCm39) missense probably benign 0.00
R6457:Krt34 UTSW 11 99,930,916 (GRCm39) missense probably damaging 1.00
R7728:Krt34 UTSW 11 99,930,811 (GRCm39) critical splice donor site probably null
R7748:Krt34 UTSW 11 99,929,764 (GRCm39) missense probably damaging 1.00
R7903:Krt34 UTSW 11 99,932,321 (GRCm39) start codon destroyed probably null 0.42
R8458:Krt34 UTSW 11 99,930,901 (GRCm39) missense probably damaging 1.00
R8480:Krt34 UTSW 11 99,930,971 (GRCm39) critical splice acceptor site probably null
R9262:Krt34 UTSW 11 99,930,851 (GRCm39) missense probably benign 0.15
R9514:Krt34 UTSW 11 99,929,226 (GRCm39) missense probably damaging 1.00
Z1176:Krt34 UTSW 11 99,932,260 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTAGGGTCTGAATACCTATTTG -3'
(R):5'- TCAGGACCATTGAGGAGCTG -3'

Sequencing Primer
(F):5'- CACACTCAGGAGAAGACATG -3'
(R):5'- TGAGAGGGTAGCCTATCTCAG -3'
Posted On 2015-04-06