Mutagenetix > Incidental Mutation

Incidental Mutation 'R3876:Krt34'

276858

Institutional Source

Beutler Lab

Gene Symbol

Krt34

Ensembl Gene

ENSMUSG00000043485

Gene Name

keratin 34

Synonyms

Krt1-4, 4733401E01Rik

MMRRC Submission

041606-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R3876 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100037347-100041554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100040965 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 143 (T143A)

Ref Sequence

ENSEMBL: ENSMUSP00000056622 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056362]

AlphaFold

Q9D646

Predicted Effect

probably benign
Transcript: ENSMUST00000056362
AA Change: T143A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000056622
Gene: ENSMUSG00000043485
AA Change: T143A

Domain	Start	End	E-Value	Type
low complexity region	11	26	N/A	INTRINSIC
Filament	55	366	7.76e-151	SMART
low complexity region	378	392	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	G	A	14: 54,591,400	R215*	probably null	Het
Brinp2	C	A	1: 158,246,846	L568F	probably damaging	Het
Brip1	T	C	11: 86,152,790	Y316C	probably damaging	Het
Cdk5rap2	ATGTG	ATG	4: 70,289,977		probably null	Het
Cfap69	G	T	5: 5,584,645		probably benign	Het
Chrnb4	T	C	9: 55,043,898	E27G	probably damaging	Het
Clec14a	A	G	12: 58,268,644	V64A	possibly damaging	Het
Crygs	A	G	16: 22,806,512	Y60H	probably damaging	Het
Dpp10	T	A	1: 123,353,487	Q611L	probably damaging	Het
Entpd1	T	C	19: 40,736,820	L450P	probably damaging	Het
Eogt	G	A	6: 97,120,190	S317L	probably damaging	Het
Exosc10	T	A	4: 148,572,919	S584T	probably benign	Het
Fam184a	C	T	10: 53,699,061	V151I	probably damaging	Het
Fbxo43	A	G	15: 36,152,112	V517A	probably damaging	Het
Flii	T	C	11: 60,719,872	T533A	possibly damaging	Het
Frmpd1	T	G	4: 45,284,093	H971Q	probably benign	Het
Gata3	A	T	2: 9,863,143	N333K	probably damaging	Het
Hectd1	A	G	12: 51,768,730	S1525P	probably damaging	Het
Ibtk	A	G	9: 85,718,426	I816T	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lipn	G	T	19: 34,069,428	M43I	probably benign	Het
Lrp1b	A	G	2: 41,445,194	C779R	probably damaging	Het
Mios	G	A	6: 8,233,189	R779Q	probably damaging	Het
Mme	A	T	3: 63,362,059		probably benign	Het
Ncstn	A	G	1: 172,070,073	S418P	probably benign	Het
Olfr1209	T	C	2: 88,909,608	T262A	possibly damaging	Het
Olfr1285	T	C	2: 111,408,622	V69A	possibly damaging	Het
Olfr5	G	A	7: 6,481,132	A8V	probably benign	Het
Olfr800	C	T	10: 129,660,274	P156L	probably benign	Het
Olfr934	T	A	9: 38,982,870	Y58F	probably damaging	Het
Oprk1	T	A	1: 5,602,661	C340*	probably null	Het
Pald1	T	A	10: 61,347,487	N323Y	probably damaging	Het
Pcdhac1	C	A	18: 37,091,892	A586E	probably damaging	Het
Pcnx2	C	T	8: 125,888,158	A185T	probably benign	Het
Pik3r1	G	A	13: 101,684,957	H430Y	probably benign	Het
Polr3b	G	A	10: 84,720,518		probably null	Het
Prl8a6	A	T	13: 27,433,032	L225*	probably null	Het
Psme4	T	C	11: 30,856,068	S89P	probably damaging	Het
Pygl	G	A	12: 70,201,339	T250I	probably damaging	Het
Rgs13	T	A	1: 144,140,790	K72*	probably null	Het
Ryr2	T	A	13: 11,588,159	I4514F	probably damaging	Het
Sept3	A	T	15: 82,285,801	D32V	probably damaging	Het
Sfrp2	C	T	3: 83,767,028	P163S	possibly damaging	Het
Spata31	A	G	13: 64,920,931	T298A	probably benign	Het
Stxbp2	T	C	8: 3,633,369		probably null	Het
Syne1	A	T	10: 5,052,345	M282K	possibly damaging	Het
Timd2	T	C	11: 46,671,020		probably null	Het
Tlr11	G	A	14: 50,363,154	V866I	probably benign	Het
Trappc10	T	C	10: 78,220,186		probably null	Het
Zfp512b	AG	AGG	2: 181,588,763		probably null	Het

Other mutations in Krt34

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00593:Krt34	APN	11	100038694	splice site	probably benign
IGL01323:Krt34	APN	11	100038780	missense	possibly damaging	0.95
IGL01403:Krt34	APN	11	100038290	missense	possibly damaging	0.88
IGL01453:Krt34	APN	11	100040090	missense	probably damaging	1.00
IGL02031:Krt34	APN	11	100039023	missense	possibly damaging	0.95
IGL02831:Krt34	APN	11	100040147	splice site	probably benign
R0024:Krt34	UTSW	11	100041037	missense	probably benign	0.01
R0024:Krt34	UTSW	11	100041037	missense	probably benign	0.01
R0220:Krt34	UTSW	11	100038693	splice site	probably benign
R0242:Krt34	UTSW	11	100041331	missense	probably damaging	1.00
R1573:Krt34	UTSW	11	100041028	missense	probably benign	0.01
R1714:Krt34	UTSW	11	100040127	missense	possibly damaging	0.95
R1879:Krt34	UTSW	11	100038292	missense	possibly damaging	0.76
R3084:Krt34	UTSW	11	100041021	missense	probably damaging	1.00
R3692:Krt34	UTSW	11	100039031	missense	probably damaging	1.00
R3819:Krt34	UTSW	11	100040018	missense	probably damaging	1.00
R3872:Krt34	UTSW	11	100041417	missense	probably benign
R6164:Krt34	UTSW	11	100038446	nonsense	probably null
R6338:Krt34	UTSW	11	100038490	missense	probably benign	0.00
R6457:Krt34	UTSW	11	100040090	missense	probably damaging	1.00
R7728:Krt34	UTSW	11	100039985	critical splice donor site	probably null
R7748:Krt34	UTSW	11	100038938	missense	probably damaging	1.00
R7903:Krt34	UTSW	11	100041495	start codon destroyed	probably null	0.42
R8458:Krt34	UTSW	11	100040075	missense	probably damaging	1.00
R8480:Krt34	UTSW	11	100040145	critical splice acceptor site	probably null
R9262:Krt34	UTSW	11	100040025	missense	probably benign	0.15
R9514:Krt34	UTSW	11	100038400	missense	probably damaging	1.00
Z1176:Krt34	UTSW	11	100041434	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGCTAGGGTCTGAATACCTATTTG -3'
(R):5'- TCAGGACCATTGAGGAGCTG -3'

Sequencing Primer
(F):5'- CACACTCAGGAGAAGACATG -3'
(R):5'- TGAGAGGGTAGCCTATCTCAG -3'

Posted On

2015-04-06