Incidental Mutation 'R3876:Clec14a'
ID276861
Institutional Source Beutler Lab
Gene Symbol Clec14a
Ensembl Gene ENSMUSG00000045930
Gene NameC-type lectin domain family 14, member a
Synonyms
MMRRC Submission 041606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3876 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location58264720-58269290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58268644 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 64 (V64A)
Ref Sequence ENSEMBL: ENSMUSP00000054451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062254
AA Change: V64A

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054451
Gene: ENSMUSG00000045930
AA Change: V64A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLECT 31 172 1.4e-5 SMART
EGF 246 288 1.85e0 SMART
transmembrane domain 388 410 N/A INTRINSIC
Meta Mutation Damage Score 0.3896 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This family member plays a role in cell-cell adhesion and angiogenesis. It functions in filopodia formation, cell migration and tube formation. Due to its presence at higher levels in tumor endothelium than in normal tissue endothelium, it is considered to be a candidate for tumor vascular targeting. [provided by RefSeq, Jan 2012]
PHENOTYPE: No notable pheontype was detected in a high-throughput screen of homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Chrnb4 T C 9: 55,043,898 E27G probably damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Dpp10 T A 1: 123,353,487 Q611L probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fam184a C T 10: 53,699,061 V151I probably damaging Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 H971Q probably benign Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt34 T C 11: 100,040,965 T143A probably benign Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr5 G A 7: 6,481,132 A8V probably benign Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Oprk1 T A 1: 5,602,661 C340* probably null Het
Pald1 T A 10: 61,347,487 N323Y probably damaging Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Prl8a6 A T 13: 27,433,032 L225* probably null Het
Psme4 T C 11: 30,856,068 S89P probably damaging Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sept3 A T 15: 82,285,801 D32V probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Stxbp2 T C 8: 3,633,369 probably null Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Clec14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Clec14a APN 12 58268318 missense probably damaging 1.00
IGL02109:Clec14a APN 12 58268148 missense probably benign 0.00
IGL02121:Clec14a APN 12 58268437 missense probably damaging 1.00
IGL02136:Clec14a APN 12 58268629 missense probably damaging 1.00
IGL02818:Clec14a APN 12 58268102 missense probably damaging 1.00
R0379:Clec14a UTSW 12 58268794 missense possibly damaging 0.90
R0382:Clec14a UTSW 12 58268617 missense probably damaging 1.00
R0419:Clec14a UTSW 12 58267665 missense probably damaging 0.97
R2972:Clec14a UTSW 12 58267574 missense probably damaging 1.00
R3796:Clec14a UTSW 12 58267909 missense probably benign 0.34
R3797:Clec14a UTSW 12 58267909 missense probably benign 0.34
R4602:Clec14a UTSW 12 58267981 missense probably benign 0.03
R4708:Clec14a UTSW 12 58267703 missense probably benign 0.00
R4994:Clec14a UTSW 12 58268284 missense probably damaging 1.00
R5193:Clec14a UTSW 12 58268614 missense probably damaging 1.00
R5489:Clec14a UTSW 12 58268249 missense probably damaging 1.00
R5671:Clec14a UTSW 12 58267826 missense probably benign 0.05
R6318:Clec14a UTSW 12 58268215 missense probably damaging 1.00
R6388:Clec14a UTSW 12 58267457 makesense probably null
R6828:Clec14a UTSW 12 58268504 missense probably damaging 1.00
R7065:Clec14a UTSW 12 58268794 missense possibly damaging 0.90
R7418:Clec14a UTSW 12 58268647 missense probably damaging 0.99
R7635:Clec14a UTSW 12 58268528 missense probably damaging 1.00
R7666:Clec14a UTSW 12 58267757 missense probably benign 0.05
R7908:Clec14a UTSW 12 58267679 missense possibly damaging 0.63
R7989:Clec14a UTSW 12 58267679 missense possibly damaging 0.63
X0024:Clec14a UTSW 12 58268326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAACGTTGTGGCTCTTC -3'
(R):5'- TTGAGTCTCCAGGATGAGGC -3'

Sequencing Primer
(F):5'- CTCTGAGTCTTCTGAGTCCGG -3'
(R):5'- AGGATGAGGCCAGCGCTTG -3'
Posted On2015-04-06