Incidental Mutation 'R3876:Prl8a6'
ID276864
Institutional Source Beutler Lab
Gene Symbol Prl8a6
Ensembl Gene ENSMUSG00000021345
Gene Nameprolactin family 8, subfamily a, member 6
SynonymsPrlpc1, PLP-Ca, PLP-calpha, Prlpc
MMRRC Submission 041606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R3876 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location27432681-27438688 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 27433032 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 225 (L225*)
Ref Sequence ENSEMBL: ENSMUSP00000105984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018392] [ENSMUST00000080762] [ENSMUST00000110355]
Predicted Effect probably null
Transcript: ENSMUST00000018392
AA Change: L224*
SMART Domains Protein: ENSMUSP00000018392
Gene: ENSMUSG00000021345
AA Change: L224*

DomainStartEndE-ValueType
Pfam:Hormone_1 16 239 2.8e-56 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000080762
AA Change: L190*
SMART Domains Protein: ENSMUSP00000079584
Gene: ENSMUSG00000021345
AA Change: L190*

DomainStartEndE-ValueType
Pfam:Hormone_1 17 86 1.9e-13 PFAM
Pfam:Hormone_1 83 205 2.4e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110355
AA Change: L225*
SMART Domains Protein: ENSMUSP00000105984
Gene: ENSMUSG00000021345
AA Change: L225*

DomainStartEndE-ValueType
Pfam:Hormone_1 17 240 1e-58 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Chrnb4 T C 9: 55,043,898 E27G probably damaging Het
Clec14a A G 12: 58,268,644 V64A possibly damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Dpp10 T A 1: 123,353,487 Q611L probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fam184a C T 10: 53,699,061 V151I probably damaging Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 H971Q probably benign Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt34 T C 11: 100,040,965 T143A probably benign Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr5 G A 7: 6,481,132 A8V probably benign Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Oprk1 T A 1: 5,602,661 C340* probably null Het
Pald1 T A 10: 61,347,487 N323Y probably damaging Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Psme4 T C 11: 30,856,068 S89P probably damaging Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sept3 A T 15: 82,285,801 D32V probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Stxbp2 T C 8: 3,633,369 probably null Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Prl8a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0157:Prl8a6 UTSW 13 27436179 splice site probably benign
R0115:Prl8a6 UTSW 13 27433101 missense probably benign 0.07
R0481:Prl8a6 UTSW 13 27433101 missense probably benign 0.07
R0514:Prl8a6 UTSW 13 27433007 nonsense probably null
R2209:Prl8a6 UTSW 13 27435386 missense probably benign 0.03
R2329:Prl8a6 UTSW 13 27437067 missense probably benign
R5259:Prl8a6 UTSW 13 27436196 nonsense probably null
R5800:Prl8a6 UTSW 13 27435470 missense probably benign
R5921:Prl8a6 UTSW 13 27437188 missense probably damaging 1.00
R6901:Prl8a6 UTSW 13 27437047 missense possibly damaging 0.87
R7182:Prl8a6 UTSW 13 27437170 missense probably damaging 1.00
R7230:Prl8a6 UTSW 13 27433038 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGATACATGTATCAGCTGATGAG -3'
(R):5'- ATGGAAGCAGCACATTTCTGAATG -3'

Sequencing Primer
(F):5'- TGATTGAGGCAAACTGAGTTTATTG -3'
(R):5'- GTATTTCTCTGATTGCACACAGAC -3'
Posted On2015-04-06