Incidental Mutation 'R3876:Sept3'
ID276870
Institutional Source Beutler Lab
Gene Symbol Sept3
Ensembl Gene ENSMUSG00000022456
Gene Nameseptin 3
SynonymsB530002E20Rik, Sep3, 3110018K01Rik
MMRRC Submission 041606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3876 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82274893-82294574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82285801 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 32 (D32V)
Ref Sequence ENSEMBL: ENSMUSP00000155353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023095] [ENSMUST00000116423] [ENSMUST00000230365] [ENSMUST00000230418] [ENSMUST00000230507]
Predicted Effect probably damaging
Transcript: ENSMUST00000023095
AA Change: D176V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023095
Gene: ENSMUSG00000022456
AA Change: D176V

DomainStartEndE-ValueType
Pfam:DUF258 27 143 9.1e-9 PFAM
Pfam:Septin 45 322 8.9e-117 PFAM
Pfam:AIG1 49 145 2.6e-7 PFAM
Pfam:MMR_HSR1 50 220 2.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116423
AA Change: D176V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112124
Gene: ENSMUSG00000022456
AA Change: D176V

DomainStartEndE-ValueType
Pfam:Septin 45 322 1.2e-116 PFAM
Pfam:MMR_HSR1 50 195 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229067
Predicted Effect probably damaging
Transcript: ENSMUST00000230365
AA Change: D176V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000230418
AA Change: D71V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000230507
AA Change: D32V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230799
Meta Mutation Damage Score 0.9728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the septin family of GTPases. Members of this family are required for cytokinesis. Expression is upregulated by retinoic acid in a human teratocarcinoma cell line. The specific function of this gene has not been determined. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Chrnb4 T C 9: 55,043,898 E27G probably damaging Het
Clec14a A G 12: 58,268,644 V64A possibly damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Dpp10 T A 1: 123,353,487 Q611L probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fam184a C T 10: 53,699,061 V151I probably damaging Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 H971Q probably benign Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt34 T C 11: 100,040,965 T143A probably benign Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr5 G A 7: 6,481,132 A8V probably benign Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Oprk1 T A 1: 5,602,661 C340* probably null Het
Pald1 T A 10: 61,347,487 N323Y probably damaging Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Prl8a6 A T 13: 27,433,032 L225* probably null Het
Psme4 T C 11: 30,856,068 S89P probably damaging Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Stxbp2 T C 8: 3,633,369 probably null Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Sept3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Sept3 APN 15 82279613 unclassified probably benign
IGL01979:Sept3 APN 15 82284392 missense probably damaging 0.99
IGL03118:Sept3 APN 15 82284514 splice site probably null
R0478:Sept3 UTSW 15 82290806 missense probably damaging 1.00
R0556:Sept3 UTSW 15 82283765 unclassified probably benign
R3804:Sept3 UTSW 15 82286429 splice site probably benign
R4589:Sept3 UTSW 15 82285891 missense probably damaging 0.99
R4744:Sept3 UTSW 15 82290457 critical splice donor site probably null
R5954:Sept3 UTSW 15 82290427 missense probably damaging 1.00
R6434:Sept3 UTSW 15 82279603 missense possibly damaging 0.92
R7257:Sept3 UTSW 15 82289213 missense probably damaging 0.99
R7475:Sept3 UTSW 15 82286456 missense probably benign 0.00
R7641:Sept3 UTSW 15 82290782 missense probably damaging 1.00
R7754:Sept3 UTSW 15 82290773 missense probably benign 0.03
R7895:Sept3 UTSW 15 82285819 missense probably benign 0.00
R7978:Sept3 UTSW 15 82285819 missense probably benign 0.00
RF020:Sept3 UTSW 15 82284461 missense probably damaging 1.00
X0065:Sept3 UTSW 15 82279504 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAAAGTTGGGGACATGCAGC -3'
(R):5'- CAGACAGGAGATGGTTTGGACC -3'

Sequencing Primer
(F):5'- GCTGAAGCAGTAGACATGTGC -3'
(R):5'- TGGTTTGGACCCAGAGGAG -3'
Posted On2015-04-06