Incidental Mutation 'R3876:Lipn'
ID 276872
Institutional Source Beutler Lab
Gene Symbol Lipn
Ensembl Gene ENSMUSG00000024770
Gene Name lipase, family member N
Synonyms 2210418G03Rik, Lipl4
MMRRC Submission 041606-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3876 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 34044758-34062318 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 34046828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 43 (M43I)
Ref Sequence ENSEMBL: ENSMUSP00000120184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025682] [ENSMUST00000126710] [ENSMUST00000148821]
AlphaFold Q3U4B4
Predicted Effect probably benign
Transcript: ENSMUST00000025682
AA Change: M43I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025682
Gene: ENSMUSG00000024770
AA Change: M43I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 1.4e-22 PFAM
Pfam:Abhydrolase_5 81 376 1.6e-10 PFAM
Pfam:Abhydrolase_1 81 382 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117028
Predicted Effect probably benign
Transcript: ENSMUST00000126710
AA Change: M43I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114551
Gene: ENSMUSG00000024770
AA Change: M43I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 100 6.4e-23 PFAM
Pfam:Abhydrolase_1 114 181 4.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148821
AA Change: M43I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120184
Gene: ENSMUSG00000024770
AA Change: M43I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 38 83 2.6e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,828,857 (GRCm39) R215* probably null Het
Brinp2 C A 1: 158,074,416 (GRCm39) L568F probably damaging Het
Brip1 T C 11: 86,043,616 (GRCm39) Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,208,214 (GRCm39) probably null Het
Cfap69 G T 5: 5,634,645 (GRCm39) probably benign Het
Chrnb4 T C 9: 54,951,182 (GRCm39) E27G probably damaging Het
Clec14a A G 12: 58,315,430 (GRCm39) V64A possibly damaging Het
Crygs A G 16: 22,625,262 (GRCm39) Y60H probably damaging Het
Dpp10 T A 1: 123,281,216 (GRCm39) Q611L probably damaging Het
Entpd1 T C 19: 40,725,264 (GRCm39) L450P probably damaging Het
Eogt G A 6: 97,097,151 (GRCm39) S317L probably damaging Het
Exosc10 T A 4: 148,657,376 (GRCm39) S584T probably benign Het
Fam184a C T 10: 53,575,157 (GRCm39) V151I probably damaging Het
Fbxo43 A G 15: 36,152,258 (GRCm39) V517A probably damaging Het
Flii T C 11: 60,610,698 (GRCm39) T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 (GRCm39) H971Q probably benign Het
Gata3 A T 2: 9,867,954 (GRCm39) N333K probably damaging Het
Hectd1 A G 12: 51,815,513 (GRCm39) S1525P probably damaging Het
Ibtk A G 9: 85,600,479 (GRCm39) I816T probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt34 T C 11: 99,931,791 (GRCm39) T143A probably benign Het
Lrp1b A G 2: 41,335,206 (GRCm39) C779R probably damaging Het
Mios G A 6: 8,233,189 (GRCm39) R779Q probably damaging Het
Mme A T 3: 63,269,480 (GRCm39) probably benign Het
Ncstn A G 1: 171,897,640 (GRCm39) S418P probably benign Het
Oprk1 T A 1: 5,672,884 (GRCm39) C340* probably null Het
Or10d1c T A 9: 38,894,166 (GRCm39) Y58F probably damaging Het
Or4c29 T C 2: 88,739,952 (GRCm39) T262A possibly damaging Het
Or4k39 T C 2: 111,238,967 (GRCm39) V69A possibly damaging Het
Or6c210 C T 10: 129,496,143 (GRCm39) P156L probably benign Het
Or6z7 G A 7: 6,484,131 (GRCm39) A8V probably benign Het
Pald1 T A 10: 61,183,266 (GRCm39) N323Y probably damaging Het
Pcdhac1 C A 18: 37,224,945 (GRCm39) A586E probably damaging Het
Pcnx2 C T 8: 126,614,897 (GRCm39) A185T probably benign Het
Pik3r1 G A 13: 101,821,465 (GRCm39) H430Y probably benign Het
Polr3b G A 10: 84,556,382 (GRCm39) probably null Het
Prl8a6 A T 13: 27,617,015 (GRCm39) L225* probably null Het
Psme4 T C 11: 30,806,068 (GRCm39) S89P probably damaging Het
Pygl G A 12: 70,248,113 (GRCm39) T250I probably damaging Het
Rgs13 T A 1: 144,016,528 (GRCm39) K72* probably null Het
Ryr2 T A 13: 11,603,045 (GRCm39) I4514F probably damaging Het
Septin3 A T 15: 82,170,002 (GRCm39) D32V probably damaging Het
Sfrp2 C T 3: 83,674,335 (GRCm39) P163S possibly damaging Het
Spata31 A G 13: 65,068,745 (GRCm39) T298A probably benign Het
Stxbp2 T C 8: 3,683,369 (GRCm39) probably null Het
Syne1 A T 10: 5,002,345 (GRCm39) M282K possibly damaging Het
Timd2 T C 11: 46,561,847 (GRCm39) probably null Het
Tlr11 G A 14: 50,600,611 (GRCm39) V866I probably benign Het
Trappc10 T C 10: 78,056,020 (GRCm39) probably null Het
Zfp512b AG AGG 2: 181,230,556 (GRCm39) probably null Het
Other mutations in Lipn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Lipn APN 19 34,056,435 (GRCm39) missense probably benign 0.06
IGL01320:Lipn APN 19 34,062,040 (GRCm39) missense probably benign 0.07
IGL01827:Lipn APN 19 34,046,880 (GRCm39) missense probably damaging 1.00
IGL02252:Lipn APN 19 34,049,157 (GRCm39) missense probably benign 0.01
IGL02422:Lipn APN 19 34,046,063 (GRCm39) missense probably benign 0.00
R0081:Lipn UTSW 19 34,054,376 (GRCm39) missense probably benign 0.00
R0284:Lipn UTSW 19 34,058,106 (GRCm39) missense possibly damaging 0.87
R0539:Lipn UTSW 19 34,062,003 (GRCm39) unclassified probably benign
R0749:Lipn UTSW 19 34,054,379 (GRCm39) missense probably damaging 1.00
R1170:Lipn UTSW 19 34,049,158 (GRCm39) missense probably benign 0.23
R1528:Lipn UTSW 19 34,046,070 (GRCm39) missense probably damaging 0.96
R1621:Lipn UTSW 19 34,046,113 (GRCm39) missense probably benign
R1675:Lipn UTSW 19 34,058,110 (GRCm39) missense probably damaging 1.00
R1869:Lipn UTSW 19 34,058,139 (GRCm39) missense possibly damaging 0.93
R3236:Lipn UTSW 19 34,046,138 (GRCm39) missense probably benign 0.17
R3237:Lipn UTSW 19 34,046,138 (GRCm39) missense probably benign 0.17
R3832:Lipn UTSW 19 34,046,933 (GRCm39) critical splice donor site probably null
R4084:Lipn UTSW 19 34,056,340 (GRCm39) missense probably benign 0.04
R4595:Lipn UTSW 19 34,058,750 (GRCm39) missense probably damaging 1.00
R5963:Lipn UTSW 19 34,058,700 (GRCm39) missense probably damaging 0.97
R6018:Lipn UTSW 19 34,054,335 (GRCm39) missense probably damaging 1.00
R6797:Lipn UTSW 19 34,058,160 (GRCm39) missense probably benign
R7090:Lipn UTSW 19 34,049,180 (GRCm39) missense possibly damaging 0.72
R7157:Lipn UTSW 19 34,054,390 (GRCm39) nonsense probably null
R7458:Lipn UTSW 19 34,049,242 (GRCm39) missense probably benign 0.10
R8824:Lipn UTSW 19 34,062,116 (GRCm39) missense probably benign 0.04
R8894:Lipn UTSW 19 34,062,248 (GRCm39) makesense probably null
R8933:Lipn UTSW 19 34,046,880 (GRCm39) missense probably damaging 0.98
R9054:Lipn UTSW 19 34,054,376 (GRCm39) missense possibly damaging 0.56
R9117:Lipn UTSW 19 34,046,041 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTAGATACCTTCCAGCATTC -3'
(R):5'- GCAGTAACTGAAGCCAATTTGG -3'

Sequencing Primer
(F):5'- CAACTACCTGCAGCTATAGA -3'
(R):5'- AGCCAATTTGGATAACGTTGTCTCC -3'
Posted On 2015-04-06