Incidental Mutation 'R3877:Ckap5'
ID276885
Institutional Source Beutler Lab
Gene Symbol Ckap5
Ensembl Gene ENSMUSG00000040549
Gene Namecytoskeleton associated protein 5
Synonyms4930432B04Rik, 3110043H24Rik, D730027C18Rik
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91526762-91620664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91615150 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1711 (K1711E)
Ref Sequence ENSEMBL: ENSMUSP00000106969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046769] [ENSMUST00000099716] [ENSMUST00000111337] [ENSMUST00000111338]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046769
AA Change: K1771E

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046263
Gene: ENSMUSG00000040549
AA Change: K1771E

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1981 1994 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099716
AA Change: K1771E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097303
Gene: ENSMUSG00000040549
AA Change: K1771E

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1909 1921 N/A INTRINSIC
low complexity region 2002 2015 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111337
AA Change: K1711E

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106969
Gene: ENSMUSG00000040549
AA Change: K1711E

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1625 1638 N/A INTRINSIC
low complexity region 1699 1711 N/A INTRINSIC
low complexity region 1849 1861 N/A INTRINSIC
low complexity region 1942 1955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111338
AA Change: K1771E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106970
Gene: ENSMUSG00000040549
AA Change: K1771E

DomainStartEndE-ValueType
TOG 1 227 9.27e-53 SMART
low complexity region 234 261 N/A INTRINSIC
TOG 269 506 1.36e-77 SMART
low complexity region 537 551 N/A INTRINSIC
TOG 586 818 1.29e-69 SMART
low complexity region 833 845 N/A INTRINSIC
TOG 850 1082 3.27e-71 SMART
TOG 1191 1429 3.32e-63 SMART
low complexity region 1685 1698 N/A INTRINSIC
low complexity region 1759 1771 N/A INTRINSIC
low complexity region 1909 1921 N/A INTRINSIC
low complexity region 2002 2015 N/A INTRINSIC
Meta Mutation Damage Score 0.0733 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein which belongs to the TOG/XMAP215 family. The N-terminal half of this protein contains a microtubule-binding domain and the C-terminal half contains a KXGS motif for binding tubulin dimers. This protein has two distinct roles in spindle formation; it protects kinetochore microtubules from depolymerization and plays an essential role in centrosomal microtubule assembly. This protein may be necessary for the proper interaction of microtubules with the cell cortex for directional cell movement. It also plays a role in translation of the myelin basic protein (MBP) mRNA by interacting with heterogeneous nuclear ribonucleoprotein (hnRNP) A2, which associates with MBP. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Ckap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Ckap5 APN 2 91606256 missense probably damaging 1.00
IGL00566:Ckap5 APN 2 91568627 splice site probably benign
IGL00585:Ckap5 APN 2 91619825 missense probably damaging 1.00
IGL00910:Ckap5 APN 2 91576050 missense probably benign 0.32
IGL01309:Ckap5 APN 2 91570184 missense probably damaging 0.99
IGL01411:Ckap5 APN 2 91601011 missense probably benign 0.26
IGL01654:Ckap5 APN 2 91577609 missense probably benign 0.26
IGL01684:Ckap5 APN 2 91555354 missense probably benign 0.06
IGL02031:Ckap5 APN 2 91612772 missense possibly damaging 0.85
IGL02057:Ckap5 APN 2 91600707 missense possibly damaging 0.91
IGL02101:Ckap5 APN 2 91572540 splice site probably benign
IGL02250:Ckap5 APN 2 91548901 missense probably damaging 1.00
IGL02556:Ckap5 APN 2 91594841 splice site probably benign
IGL02620:Ckap5 APN 2 91606369 missense probably benign 0.01
IGL02627:Ckap5 APN 2 91576021 missense probably damaging 1.00
IGL02693:Ckap5 APN 2 91570211 missense probably damaging 1.00
IGL02808:Ckap5 APN 2 91596514 missense probably damaging 1.00
IGL03086:Ckap5 APN 2 91570276 splice site probably benign
K7371:Ckap5 UTSW 2 91595523 splice site probably benign
R0106:Ckap5 UTSW 2 91578205 missense possibly damaging 0.90
R0106:Ckap5 UTSW 2 91615840 missense probably damaging 1.00
R0114:Ckap5 UTSW 2 91620112 missense possibly damaging 0.86
R0464:Ckap5 UTSW 2 91579513 missense probably benign 0.00
R0633:Ckap5 UTSW 2 91550743 missense probably damaging 0.96
R0723:Ckap5 UTSW 2 91555331 missense probably damaging 0.99
R1037:Ckap5 UTSW 2 91550629 missense probably benign 0.00
R1139:Ckap5 UTSW 2 91581143 missense probably benign 0.11
R1161:Ckap5 UTSW 2 91599375 missense probably null 1.00
R1183:Ckap5 UTSW 2 91586266 missense probably benign 0.01
R1660:Ckap5 UTSW 2 91562958 missense possibly damaging 0.92
R1850:Ckap5 UTSW 2 91595713 missense probably damaging 1.00
R1951:Ckap5 UTSW 2 91556492 splice site probably benign
R1968:Ckap5 UTSW 2 91586343 missense probably benign 0.10
R2004:Ckap5 UTSW 2 91607546 missense possibly damaging 0.91
R2143:Ckap5 UTSW 2 91565745 missense probably benign 0.00
R2391:Ckap5 UTSW 2 91585869 missense possibly damaging 0.66
R2435:Ckap5 UTSW 2 91581145 missense probably benign 0.01
R2438:Ckap5 UTSW 2 91595408 missense possibly damaging 0.95
R2680:Ckap5 UTSW 2 91588698 missense probably benign
R2698:Ckap5 UTSW 2 91578081 missense probably damaging 1.00
R3420:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R3422:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R3696:Ckap5 UTSW 2 91620166 missense probably benign 0.15
R3698:Ckap5 UTSW 2 91620166 missense probably benign 0.15
R4453:Ckap5 UTSW 2 91548845 missense probably damaging 1.00
R4604:Ckap5 UTSW 2 91578131 missense probably benign 0.00
R4605:Ckap5 UTSW 2 91576214 missense probably damaging 1.00
R4849:Ckap5 UTSW 2 91615271 missense probably damaging 1.00
R5267:Ckap5 UTSW 2 91591752 missense probably null 1.00
R5367:Ckap5 UTSW 2 91615141 missense possibly damaging 0.69
R5481:Ckap5 UTSW 2 91572447 missense possibly damaging 0.62
R5546:Ckap5 UTSW 2 91594816 missense probably damaging 1.00
R5704:Ckap5 UTSW 2 91576203 missense probably damaging 1.00
R5786:Ckap5 UTSW 2 91616296 splice site probably null
R5793:Ckap5 UTSW 2 91619835 missense possibly damaging 0.74
R5824:Ckap5 UTSW 2 91559136 missense probably benign 0.34
R5841:Ckap5 UTSW 2 91600682 missense probably benign 0.05
R5875:Ckap5 UTSW 2 91560861 missense probably benign
R5935:Ckap5 UTSW 2 91615100 missense possibly damaging 0.68
R6008:Ckap5 UTSW 2 91562989 missense probably damaging 0.99
R6174:Ckap5 UTSW 2 91568219 missense probably benign 0.00
R6343:Ckap5 UTSW 2 91596474 missense possibly damaging 0.95
R6624:Ckap5 UTSW 2 91577651 missense probably benign 0.01
R6786:Ckap5 UTSW 2 91557575 missense probably benign 0.01
R6793:Ckap5 UTSW 2 91568709 missense probably damaging 1.00
R6841:Ckap5 UTSW 2 91570252 missense probably damaging 0.99
R6972:Ckap5 UTSW 2 91606313 missense probably damaging 0.98
R7044:Ckap5 UTSW 2 91577601 missense probably benign
R7111:Ckap5 UTSW 2 91607572 missense probably damaging 1.00
R7790:Ckap5 UTSW 2 91559110 missense probably benign
R7809:Ckap5 UTSW 2 91606357 missense probably benign 0.28
X0010:Ckap5 UTSW 2 91596509 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CTATGGAGAATGGTTCGACTATTACC -3'
(R):5'- ATTCGAGAAGCTCCCTTTTCTG -3'

Sequencing Primer
(F):5'- GAATGGTTCGACTATTACCTGACACC -3'
(R):5'- AGACTTGCTCCCAGTCTGG -3'
Posted On2015-04-06