Incidental Mutation 'R3877:Mapre1'
ID276887
Institutional Source Beutler Lab
Gene Symbol Mapre1
Ensembl Gene ENSMUSG00000027479
Gene Namemicrotubule-associated protein, RP/EB family, member 1
SynonymsEb1, 5530600P05Rik, BIM1p, D2Ertd459e
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.576) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153741274-153773310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 153746281 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 8 (T8M)
Ref Sequence ENSEMBL: ENSMUSP00000028981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028981]
PDB Structure
Solution structure of the CH domain from mouse EB-1 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028981
AA Change: T8M

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028981
Gene: ENSMUSG00000027479
AA Change: T8M

DomainStartEndE-ValueType
Pfam:CH 14 114 5.2e-11 PFAM
Pfam:EB1 210 248 1.2e-20 PFAM
low complexity region 256 267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123795
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was first identified by its binding to the APC protein which is often mutated in familial and sporadic forms of colorectal cancer. This protein localizes to microtubules, especially the growing ends, in interphase cells. During mitosis, the protein is associated with the centrosomes and spindle microtubules. The protein also associates with components of the dynactin complex and the intermediate chain of cytoplasmic dynein. Because of these associations, it is thought that this protein is involved in the regulation of microtubule structures and chromosome stability. This gene is a member of the RP/EB family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Mapre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Mapre1 APN 2 153746314 missense probably damaging 1.00
R1157:Mapre1 UTSW 2 153758017 missense probably benign 0.04
R5184:Mapre1 UTSW 2 153758067 missense possibly damaging 0.49
R7133:Mapre1 UTSW 2 153764963 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TAGTATCTGGTTTCACCCCTTAGG -3'
(R):5'- TGCGGTGGCTCCATATAGAG -3'

Sequencing Primer
(F):5'- GGAATAAGGCTGTGCTTAAAATTG -3'
(R):5'- GCCTGCCTGGTCTATAGAGTAAAC -3'
Posted On2015-04-06