Incidental Mutation 'R3877:Kirrel1'
ID 276892
Institutional Source Beutler Lab
Gene Symbol Kirrel1
Ensembl Gene ENSMUSG00000041734
Gene Name kirre like nephrin family adhesion molecule 1
Synonyms 6720469N11Rik, Neph1, Kirrel1, Kirrel
MMRRC Submission 040904-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3877 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 86985900-87082054 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86996458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 380 (M380I)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
AlphaFold Q80W68
Predicted Effect probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 G A 8: 41,249,671 (GRCm39) V594I possibly damaging Het
Adgb A T 10: 10,318,227 (GRCm39) probably null Het
Adgrb3 A C 1: 25,150,906 (GRCm39) L1109R probably damaging Het
Angptl4 G A 17: 33,996,008 (GRCm39) P323S possibly damaging Het
Arhgap21 A T 2: 20,864,717 (GRCm39) M1197K probably damaging Het
Arhgef40 A G 14: 52,239,742 (GRCm39) T1319A probably damaging Het
C4bp A G 1: 130,575,764 (GRCm39) probably null Het
Cd200r1 T C 16: 44,610,374 (GRCm39) S161P possibly damaging Het
Ckap5 A G 2: 91,445,495 (GRCm39) K1711E possibly damaging Het
Cldn19 T C 4: 119,114,094 (GRCm39) S79P possibly damaging Het
Cplane1 T C 15: 8,251,427 (GRCm39) S1900P probably benign Het
Dnah17 T G 11: 117,915,533 (GRCm39) N4334T probably damaging Het
Dpm2 G A 2: 32,462,412 (GRCm39) probably null Het
Eef1a2 A T 2: 180,794,626 (GRCm39) V191E probably damaging Het
Gmds G A 13: 32,411,248 (GRCm39) T62I probably damaging Het
Hyal5 A T 6: 24,876,630 (GRCm39) I168F probably damaging Het
Idh3a T C 9: 54,499,679 (GRCm39) V31A probably benign Het
Inf2 C A 12: 112,577,264 (GRCm39) A1036E unknown Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kidins220 T A 12: 25,051,564 (GRCm39) probably benign Het
Lrp1b A G 2: 41,335,206 (GRCm39) C779R probably damaging Het
Lrp2 A G 2: 69,289,816 (GRCm39) probably null Het
Lrp2 G A 2: 69,379,391 (GRCm39) T107M probably damaging Het
Lrpap1 T C 5: 35,255,547 (GRCm39) E184G probably benign Het
Mapre1 C T 2: 153,588,201 (GRCm39) T8M possibly damaging Het
Mms19 G A 19: 41,954,695 (GRCm39) Q75* probably null Het
Mtcl1 T C 17: 66,649,949 (GRCm39) I1390V probably damaging Het
Muc5b A G 7: 141,411,289 (GRCm39) S1412G unknown Het
Myh4 A T 11: 67,148,009 (GRCm39) Q1686L probably benign Het
Or1e25 A T 11: 73,493,979 (GRCm39) D191V probably damaging Het
Or9s13 A T 1: 92,547,805 (GRCm39) D59V probably damaging Het
Rcvrn A T 11: 67,590,802 (GRCm39) I129F probably damaging Het
Reg3b T A 6: 78,348,216 (GRCm39) M10K possibly damaging Het
Rimbp2 T A 5: 128,850,529 (GRCm39) E918V probably damaging Het
Rpl5 A G 5: 108,051,667 (GRCm39) T154A probably benign Het
Sall4 A C 2: 168,598,162 (GRCm39) L195R probably damaging Het
Sh3gl2 T C 4: 85,297,618 (GRCm39) S199P possibly damaging Het
Shank1 G T 7: 43,994,416 (GRCm39) R859L unknown Het
Thsd7b A G 1: 130,117,919 (GRCm39) E1445G possibly damaging Het
Tnfaip6 A G 2: 51,942,339 (GRCm39) E216G probably benign Het
Tram1 T C 1: 13,639,827 (GRCm39) T307A probably benign Het
Trpv5 A G 6: 41,637,277 (GRCm39) V354A probably benign Het
Tyro3 A G 2: 119,643,774 (GRCm39) E745G probably damaging Het
Vmn1r68 A T 7: 10,261,408 (GRCm39) I230N probably damaging Het
Vmn2r28 A T 7: 5,491,357 (GRCm39) W297R probably damaging Het
Vrk3 A T 7: 44,412,460 (GRCm39) probably null Het
Zfhx4 T C 3: 5,465,845 (GRCm39) V2001A probably benign Het
Zfp512b AG AGG 2: 181,230,556 (GRCm39) probably null Het
Other mutations in Kirrel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel1 APN 3 86,997,182 (GRCm39) missense probably benign 0.22
IGL01865:Kirrel1 APN 3 86,993,731 (GRCm39) missense probably damaging 1.00
IGL01875:Kirrel1 APN 3 87,003,037 (GRCm39) missense probably damaging 1.00
IGL02337:Kirrel1 APN 3 86,996,519 (GRCm39) missense possibly damaging 0.64
IGL02724:Kirrel1 APN 3 86,997,780 (GRCm39) nonsense probably null
IGL02825:Kirrel1 APN 3 86,996,595 (GRCm39) splice site probably benign
IGL02826:Kirrel1 APN 3 86,995,792 (GRCm39) missense probably damaging 1.00
IGL03102:Kirrel1 APN 3 86,990,807 (GRCm39) missense probably damaging 0.98
D4043:Kirrel1 UTSW 3 86,990,510 (GRCm39) missense probably benign 0.02
R0360:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0364:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0421:Kirrel1 UTSW 3 86,990,914 (GRCm39) missense probably damaging 0.99
R0503:Kirrel1 UTSW 3 87,005,109 (GRCm39) missense probably benign 0.20
R1112:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1116:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1144:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1190:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1226:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1501:Kirrel1 UTSW 3 86,997,779 (GRCm39) missense probably benign 0.02
R1538:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1546:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1628:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1630:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1631:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1664:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1671:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1695:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1769:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1807:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1808:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1840:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1995:Kirrel1 UTSW 3 87,003,093 (GRCm39) missense possibly damaging 0.88
R2014:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2086:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2108:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2354:Kirrel1 UTSW 3 86,995,792 (GRCm39) missense probably damaging 0.98
R2407:Kirrel1 UTSW 3 86,992,150 (GRCm39) missense probably benign 0.03
R2904:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2905:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2958:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2959:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2960:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2961:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3026:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3028:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3034:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R3149:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3195:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3196:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3499:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3699:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3720:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3721:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3788:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3793:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3901:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3910:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3911:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3912:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3913:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3930:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3931:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4022:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4067:Kirrel1 UTSW 3 86,995,774 (GRCm39) nonsense probably null
R4077:Kirrel1 UTSW 3 86,992,387 (GRCm39) critical splice donor site probably null
R4198:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4328:Kirrel1 UTSW 3 86,992,081 (GRCm39) intron probably benign
R4355:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4363:Kirrel1 UTSW 3 86,997,792 (GRCm39) nonsense probably null
R4378:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4386:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4460:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4468:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4469:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4650:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4652:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4734:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4748:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4749:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R5304:Kirrel1 UTSW 3 86,996,902 (GRCm39) missense probably benign 0.02
R5534:Kirrel1 UTSW 3 86,997,825 (GRCm39) missense probably damaging 1.00
R5604:Kirrel1 UTSW 3 86,996,462 (GRCm39) missense possibly damaging 0.69
R7199:Kirrel1 UTSW 3 86,990,695 (GRCm39) missense probably benign 0.02
R7221:Kirrel1 UTSW 3 86,993,704 (GRCm39) nonsense probably null
R7284:Kirrel1 UTSW 3 86,990,694 (GRCm39) missense probably benign 0.02
R7332:Kirrel1 UTSW 3 86,995,705 (GRCm39) missense probably benign 0.14
R7369:Kirrel1 UTSW 3 87,048,391 (GRCm39) missense probably benign 0.20
R7371:Kirrel1 UTSW 3 86,995,729 (GRCm39) missense probably benign 0.44
R7508:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R7566:Kirrel1 UTSW 3 86,995,791 (GRCm39) missense probably damaging 1.00
R7567:Kirrel1 UTSW 3 87,002,988 (GRCm39) missense probably damaging 0.99
R7621:Kirrel1 UTSW 3 86,995,528 (GRCm39) missense possibly damaging 0.70
R8030:Kirrel1 UTSW 3 87,005,082 (GRCm39) missense probably damaging 1.00
R8141:Kirrel1 UTSW 3 86,993,735 (GRCm39) nonsense probably null
R8261:Kirrel1 UTSW 3 86,995,309 (GRCm39) intron probably benign
R8477:Kirrel1 UTSW 3 86,992,138 (GRCm39) missense possibly damaging 0.71
R8512:Kirrel1 UTSW 3 86,995,534 (GRCm39) missense probably benign 0.00
R8954:Kirrel1 UTSW 3 86,997,173 (GRCm39) missense probably benign 0.25
R8987:Kirrel1 UTSW 3 86,992,400 (GRCm39) missense probably damaging 1.00
R9058:Kirrel1 UTSW 3 86,992,442 (GRCm39) missense probably benign 0.18
R9146:Kirrel1 UTSW 3 87,003,015 (GRCm39) missense probably damaging 1.00
R9311:Kirrel1 UTSW 3 87,005,123 (GRCm39) missense probably benign 0.29
R9527:Kirrel1 UTSW 3 86,996,912 (GRCm39) nonsense probably null
R9629:Kirrel1 UTSW 3 87,003,025 (GRCm39) nonsense probably null
Z1177:Kirrel1 UTSW 3 86,991,182 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACCCTGAGTTCTATGCAAGTC -3'
(R):5'- GCTGATGATTCTCAGGCACC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'
Posted On 2015-04-06