Incidental Mutation 'R3877:Rpl5'
ID276897
Institutional Source Beutler Lab
Gene Symbol Rpl5
Ensembl Gene ENSMUSG00000058558
Gene Nameribosomal protein L5
SynonymsU21RNA
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107900502-107909005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107903801 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 154 (T154A)
Ref Sequence ENSEMBL: ENSMUSP00000080854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031198] [ENSMUST00000082223] [ENSMUST00000153590]
Predicted Effect probably benign
Transcript: ENSMUST00000031198
SMART Domains Protein: ENSMUSP00000031198
Gene: ENSMUSG00000029270

DomainStartEndE-ValueType
PIP49_N 19 177 1.7e-92 SMART
Pfam:PIP49_C 194 396 1.9e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082223
AA Change: T154A

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080854
Gene: ENSMUSG00000058558
AA Change: T154A

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
Pfam:Ribosomal_L18p 26 173 2.1e-46 PFAM
Pfam:Ribosomal_L18_c 192 283 2.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151767
Predicted Effect probably benign
Transcript: ENSMUST00000153590
AA Change: T104A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123474
Gene: ENSMUSG00000058558
AA Change: T104A

DomainStartEndE-ValueType
Pfam:Ribosomal_L18p 1 123 6.3e-37 PFAM
Pfam:Ribosomal_L18_c 142 163 2.7e-8 PFAM
Meta Mutation Damage Score 0.3038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L18P family of ribosomal proteins. It is located in the cytoplasm. The protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The protein interacts specifically with the beta subunit of casein kinase II. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Rpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rpl5 APN 5 107907279 critical splice donor site probably null
IGL01694:Rpl5 APN 5 107907240 missense probably benign 0.00
PIT4142001:Rpl5 UTSW 5 107907183 unclassified probably benign
R0070:Rpl5 UTSW 5 107901900 missense probably benign 0.13
R0153:Rpl5 UTSW 5 107904757 missense probably benign 0.00
R4502:Rpl5 UTSW 5 107904857 missense possibly damaging 0.92
R4503:Rpl5 UTSW 5 107904857 missense possibly damaging 0.92
R5654:Rpl5 UTSW 5 107903648 intron probably benign
R6955:Rpl5 UTSW 5 107902046 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCGTTTAGATAGGCAGCAAAGC -3'
(R):5'- TCCTTGTACAGTAACTACACAGAAC -3'

Sequencing Primer
(F):5'- GCCCAGGTACCTATATAAAGACTG -3'
(R):5'- CTACACAGAACAGGCATTGAATG -3'
Posted On2015-04-06