Mutagenetix > Incidental Mutation

Incidental Mutation 'R3877:Rpl5'

276897

Institutional Source

Beutler Lab

Gene Symbol

Rpl5

Ensembl Gene

ENSMUSG00000058558

Gene Name

ribosomal protein L5

Synonyms

U21RNA, Skax23, Ska23, Ska

MMRRC Submission

040904-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R3877 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108048388-108056871 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108051667 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 154 (T154A)

Ref Sequence

ENSEMBL: ENSMUSP00000080854 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031198] [ENSMUST00000082223] [ENSMUST00000153590]

AlphaFold

P47962

Predicted Effect

probably benign
Transcript: ENSMUST00000031198

SMART Domains

Protein: ENSMUSP00000031198
Gene: ENSMUSG00000029270

Domain	Start	End	E-Value	Type
PIP49_N	19	177	1.7e-92	SMART
Pfam:PIP49_C	194	396	1.9e-69	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000082223
AA Change: T154A

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000080854
Gene: ENSMUSG00000058558
AA Change: T154A

Domain	Start	End	E-Value	Type
low complexity region	19	24	N/A	INTRINSIC
Pfam:Ribosomal_L18p	26	173	2.1e-46	PFAM
Pfam:Ribosomal_L18_c	192	283	2.2e-42	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104034

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104238

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123183

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129944

Predicted Effect

probably benign
Transcript: ENSMUST00000153590
AA Change: T104A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000123474
Gene: ENSMUSG00000058558
AA Change: T104A

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18p	1	123	6.3e-37	PFAM
Pfam:Ribosomal_L18_c	142	163	2.7e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140659

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151767

Meta Mutation Damage Score

0.3038

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.2%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L18P family of ribosomal proteins. It is located in the cytoplasm. The protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The protein interacts specifically with the beta subunit of casein kinase II. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam20	G	A	8: 41,249,671 (GRCm39)	V594I	possibly damaging	Het
Adgb	A	T	10: 10,318,227 (GRCm39)		probably null	Het
Adgrb3	A	C	1: 25,150,906 (GRCm39)	L1109R	probably damaging	Het
Angptl4	G	A	17: 33,996,008 (GRCm39)	P323S	possibly damaging	Het
Arhgap21	A	T	2: 20,864,717 (GRCm39)	M1197K	probably damaging	Het
Arhgef40	A	G	14: 52,239,742 (GRCm39)	T1319A	probably damaging	Het
C4bp	A	G	1: 130,575,764 (GRCm39)		probably null	Het
Cd200r1	T	C	16: 44,610,374 (GRCm39)	S161P	possibly damaging	Het
Ckap5	A	G	2: 91,445,495 (GRCm39)	K1711E	possibly damaging	Het
Cldn19	T	C	4: 119,114,094 (GRCm39)	S79P	possibly damaging	Het
Cplane1	T	C	15: 8,251,427 (GRCm39)	S1900P	probably benign	Het
Dnah17	T	G	11: 117,915,533 (GRCm39)	N4334T	probably damaging	Het
Dpm2	G	A	2: 32,462,412 (GRCm39)		probably null	Het
Eef1a2	A	T	2: 180,794,626 (GRCm39)	V191E	probably damaging	Het
Gmds	G	A	13: 32,411,248 (GRCm39)	T62I	probably damaging	Het
Hyal5	A	T	6: 24,876,630 (GRCm39)	I168F	probably damaging	Het
Idh3a	T	C	9: 54,499,679 (GRCm39)	V31A	probably benign	Het
Inf2	C	A	12: 112,577,264 (GRCm39)	A1036E	unknown	Het
Kcnd3	C	T	3: 105,566,082 (GRCm39)	A421V	probably damaging	Het
Kidins220	T	A	12: 25,051,564 (GRCm39)		probably benign	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Lrp1b	A	G	2: 41,335,206 (GRCm39)	C779R	probably damaging	Het
Lrp2	A	G	2: 69,289,816 (GRCm39)		probably null	Het
Lrp2	G	A	2: 69,379,391 (GRCm39)	T107M	probably damaging	Het
Lrpap1	T	C	5: 35,255,547 (GRCm39)	E184G	probably benign	Het
Mapre1	C	T	2: 153,588,201 (GRCm39)	T8M	possibly damaging	Het
Mms19	G	A	19: 41,954,695 (GRCm39)	Q75*	probably null	Het
Mtcl1	T	C	17: 66,649,949 (GRCm39)	I1390V	probably damaging	Het
Muc5b	A	G	7: 141,411,289 (GRCm39)	S1412G	unknown	Het
Myh4	A	T	11: 67,148,009 (GRCm39)	Q1686L	probably benign	Het
Or1e25	A	T	11: 73,493,979 (GRCm39)	D191V	probably damaging	Het
Or9s13	A	T	1: 92,547,805 (GRCm39)	D59V	probably damaging	Het
Rcvrn	A	T	11: 67,590,802 (GRCm39)	I129F	probably damaging	Het
Reg3b	T	A	6: 78,348,216 (GRCm39)	M10K	possibly damaging	Het
Rimbp2	T	A	5: 128,850,529 (GRCm39)	E918V	probably damaging	Het
Sall4	A	C	2: 168,598,162 (GRCm39)	L195R	probably damaging	Het
Sh3gl2	T	C	4: 85,297,618 (GRCm39)	S199P	possibly damaging	Het
Shank1	G	T	7: 43,994,416 (GRCm39)	R859L	unknown	Het
Thsd7b	A	G	1: 130,117,919 (GRCm39)	E1445G	possibly damaging	Het
Tnfaip6	A	G	2: 51,942,339 (GRCm39)	E216G	probably benign	Het
Tram1	T	C	1: 13,639,827 (GRCm39)	T307A	probably benign	Het
Trpv5	A	G	6: 41,637,277 (GRCm39)	V354A	probably benign	Het
Tyro3	A	G	2: 119,643,774 (GRCm39)	E745G	probably damaging	Het
Vmn1r68	A	T	7: 10,261,408 (GRCm39)	I230N	probably damaging	Het
Vmn2r28	A	T	7: 5,491,357 (GRCm39)	W297R	probably damaging	Het
Vrk3	A	T	7: 44,412,460 (GRCm39)		probably null	Het
Zfhx4	T	C	3: 5,465,845 (GRCm39)	V2001A	probably benign	Het
Zfp512b	AG	AGG	2: 181,230,556 (GRCm39)		probably null	Het

Other mutations in Rpl5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Rpl5	APN	5	108,055,145 (GRCm39)	critical splice donor site	probably null
IGL01694:Rpl5	APN	5	108,055,106 (GRCm39)	missense	probably benign	0.00
PIT4142001:Rpl5	UTSW	5	108,055,049 (GRCm39)	unclassified	probably benign
R0070:Rpl5	UTSW	5	108,049,766 (GRCm39)	missense	probably benign	0.13
R0153:Rpl5	UTSW	5	108,052,623 (GRCm39)	missense	probably benign	0.00
R4502:Rpl5	UTSW	5	108,052,723 (GRCm39)	missense	possibly damaging	0.92
R4503:Rpl5	UTSW	5	108,052,723 (GRCm39)	missense	possibly damaging	0.92
R5654:Rpl5	UTSW	5	108,051,514 (GRCm39)	intron	probably benign
R6955:Rpl5	UTSW	5	108,049,912 (GRCm39)	missense	probably benign	0.01
R9536:Rpl5	UTSW	5	108,051,721 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCGTTTAGATAGGCAGCAAAGC -3'
(R):5'- TCCTTGTACAGTAACTACACAGAAC -3'

Sequencing Primer
(F):5'- GCCCAGGTACCTATATAAAGACTG -3'
(R):5'- CTACACAGAACAGGCATTGAATG -3'

Posted On

2015-04-06