Incidental Mutation 'R3877:Adam20'
ID276909
Institutional Source Beutler Lab
Gene Symbol Adam20
Ensembl Gene ENSMUSG00000046282
Gene Namea disintegrin and metallopeptidase domain 20
Synonyms4930529F22Rik
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location40793273-40797303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40796634 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 594 (V594I)
Ref Sequence ENSEMBL: ENSMUSP00000057794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056331]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056331
AA Change: V594I

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057794
Gene: ENSMUSG00000046282
AA Change: V594I

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 51 177 1.3e-19 PFAM
Pfam:Reprolysin_5 219 399 5.4e-16 PFAM
Pfam:Reprolysin_4 219 408 5.4e-11 PFAM
Pfam:Reprolysin 221 411 3.1e-45 PFAM
Pfam:Reprolysin_3 248 366 2.5e-13 PFAM
Pfam:Reprolysin_2 295 403 1e-14 PFAM
DISIN 429 504 4.29e-33 SMART
ACR 505 641 3.9e-74 SMART
transmembrane domain 703 722 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P possibly damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Adam20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Adam20 APN 8 40796047 missense probably benign 0.00
IGL01357:Adam20 APN 8 40796560 missense probably benign 0.09
IGL01877:Adam20 APN 8 40795945 missense probably benign 0.00
IGL02295:Adam20 APN 8 40796836 missense probably damaging 1.00
IGL02683:Adam20 APN 8 40795584 missense probably damaging 0.98
IGL03090:Adam20 APN 8 40794928 missense probably benign 0.00
PIT4151001:Adam20 UTSW 8 40795044 missense possibly damaging 0.58
PIT4696001:Adam20 UTSW 8 40794948 missense probably benign 0.20
R0607:Adam20 UTSW 8 40795480 missense probably benign 0.02
R0885:Adam20 UTSW 8 40796558 missense probably benign 0.02
R1018:Adam20 UTSW 8 40796109 nonsense probably null
R1147:Adam20 UTSW 8 40795618 missense possibly damaging 0.82
R1147:Adam20 UTSW 8 40795618 missense possibly damaging 0.82
R1421:Adam20 UTSW 8 40796747 missense possibly damaging 0.48
R1739:Adam20 UTSW 8 40796558 missense probably benign 0.02
R1778:Adam20 UTSW 8 40796661 missense possibly damaging 0.92
R1844:Adam20 UTSW 8 40796043 missense probably benign
R3814:Adam20 UTSW 8 40795675 missense probably damaging 1.00
R4193:Adam20 UTSW 8 40795315 missense probably damaging 0.99
R4357:Adam20 UTSW 8 40795047 missense possibly damaging 0.61
R4846:Adam20 UTSW 8 40795011 missense probably benign 0.10
R5452:Adam20 UTSW 8 40795764 missense probably damaging 0.96
R6559:Adam20 UTSW 8 40796292 missense probably benign 0.03
R6708:Adam20 UTSW 8 40796494 missense probably damaging 1.00
R6730:Adam20 UTSW 8 40796659 missense probably benign 0.23
R7194:Adam20 UTSW 8 40796412 missense probably benign 0.45
R7323:Adam20 UTSW 8 40795384 missense probably benign 0.45
X0062:Adam20 UTSW 8 40797024 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCAAATCTTCGGCAAAGAAGC -3'
(R):5'- GGCAGTGATGTAAATTGTTGCAC -3'

Sequencing Primer
(F):5'- GCCAGGAGTGCAGATCAC -3'
(R):5'- GTACATGTCTTGGATGAACACTG -3'
Posted On2015-04-06