Mutagenetix > Incidental Mutation

Incidental Mutation 'R3877:Adgb'

276911

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

MMRRC Submission

040904-MU

Accession Numbers

MGI:3605549

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3877 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10335703-10472326 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 10442483 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000132573] [ENSMUST00000132573] [ENSMUST00000132573] [ENSMUST00000132573] [ENSMUST00000172530] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000179956] [ENSMUST00000208717] [ENSMUST00000208717] [ENSMUST00000208717] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

probably null
Transcript: ENSMUST00000132573

SMART Domains

Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000132573

SMART Domains

Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000132573

SMART Domains

Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000132573

SMART Domains

Protein: ENSMUSP00000120422
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000172530

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000172530

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000179956

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000179956

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000208717

Predicted Effect

probably null
Transcript: ENSMUST00000208717

Predicted Effect

probably null
Transcript: ENSMUST00000208717

Predicted Effect

probably null
Transcript: ENSMUST00000208717

Meta Mutation Damage Score

0.9479

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.2%

Validation Efficiency

100% (49/49)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,221,943	S1900P	probably benign	Het
Adam20	G	A	8: 40,796,634	V594I	possibly damaging	Het
Adgrb3	A	C	1: 25,111,825	L1109R	probably damaging	Het
Angptl4	G	A	17: 33,777,034	P323S	possibly damaging	Het
Arhgap21	A	T	2: 20,859,906	M1197K	probably damaging	Het
Arhgef40	A	G	14: 52,002,285	T1319A	probably damaging	Het
C4bp	A	G	1: 130,648,027		probably null	Het
Cd200r1	T	C	16: 44,790,011	S161P	possibly damaging	Het
Ckap5	A	G	2: 91,615,150	K1711E	possibly damaging	Het
Cldn19	T	C	4: 119,256,897	S79P	possibly damaging	Het
Dnah17	T	G	11: 118,024,707	N4334T	probably damaging	Het
Dpm2	G	A	2: 32,572,400		probably null	Het
Eef1a2	A	T	2: 181,152,833	V191E	probably damaging	Het
Gmds	G	A	13: 32,227,265	T62I	probably damaging	Het
Hyal5	A	T	6: 24,876,631	I168F	probably damaging	Het
Idh3a	T	C	9: 54,592,395	V31A	probably benign	Het
Inf2	C	A	12: 112,610,830	A1036E	unknown	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kidins220	T	A	12: 25,001,565		probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrp1b	A	G	2: 41,445,194	C779R	probably damaging	Het
Lrp2	A	G	2: 69,459,472		probably null	Het
Lrp2	G	A	2: 69,549,047	T107M	probably damaging	Het
Lrpap1	T	C	5: 35,098,203	E184G	probably benign	Het
Mapre1	C	T	2: 153,746,281	T8M	possibly damaging	Het
Mms19	G	A	19: 41,966,256	Q75*	probably null	Het
Mtcl1	T	C	17: 66,342,954	I1390V	probably damaging	Het
Muc5b	A	G	7: 141,857,552	S1412G	unknown	Het
Myh4	A	T	11: 67,257,183	Q1686L	probably benign	Het
Olfr12	A	T	1: 92,620,083	D59V	probably damaging	Het
Olfr384	A	T	11: 73,603,153	D191V	probably damaging	Het
Rcvrn	A	T	11: 67,699,976	I129F	probably damaging	Het
Reg3b	T	A	6: 78,371,233	M10K	possibly damaging	Het
Rimbp2	T	A	5: 128,773,465	E918V	probably damaging	Het
Rpl5	A	G	5: 107,903,801	T154A	probably benign	Het
Sall4	A	C	2: 168,756,242	L195R	probably damaging	Het
Sh3gl2	T	C	4: 85,379,381	S199P	possibly damaging	Het
Shank1	G	T	7: 44,344,992	R859L	unknown	Het
Thsd7b	A	G	1: 130,190,182	E1445G	possibly damaging	Het
Tnfaip6	A	G	2: 52,052,327	E216G	probably benign	Het
Tram1	T	C	1: 13,569,603	T307A	probably benign	Het
Trpv5	A	G	6: 41,660,343	V354A	probably benign	Het
Tyro3	A	G	2: 119,813,293	E745G	probably damaging	Het
Vmn1r68	A	T	7: 10,527,481	I230N	probably damaging	Het
Vmn2r28	A	T	7: 5,488,358	W297R	probably damaging	Het
Vrk3	A	T	7: 44,763,036		probably null	Het
Zfhx4	T	C	3: 5,400,785	V2001A	probably benign	Het
Zfp512b	AG	AGG	2: 181,588,763		probably null	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10406099	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10407554	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10400572	missense	probably benign	0.02
R0080:Adgb	UTSW	10	10377839	splice site	probably benign
R0084:Adgb	UTSW	10	10396344	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10407158	splice site	probably benign
R0348:Adgb	UTSW	10	10357879	missense	probably benign
R0415:Adgb	UTSW	10	10431067	splice site	probably null
R0633:Adgb	UTSW	10	10391729	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10442613	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10395310	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10382828	missense	probably damaging	1.00
R1568:Adgb	UTSW	10	10442665	nonsense	probably null
R1647:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10339675	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10350317	nonsense	probably null
R1758:Adgb	UTSW	10	10426605	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10382721	splice site	probably benign
R1850:Adgb	UTSW	10	10442502	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10395249	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10433498	missense	probably benign
R2179:Adgb	UTSW	10	10395274	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10436051	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10377891	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10390243	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R3722:Adgb	UTSW	10	10340510	missense	probably benign	0.32
R3846:Adgb	UTSW	10	10382721	splice site	probably benign
R4210:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4333:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R4448:Adgb	UTSW	10	10390825	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10398951	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10403004	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10405306	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10426710	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10398903	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10357872	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10349577	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10400632	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10357978	missense	probably benign	0.11
R5157:Adgb	UTSW	10	10398966	missense	probably damaging	1.00
R5209:Adgb	UTSW	10	10398937	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10442606	missense	probably damaging	1.00
R5376:Adgb	UTSW	10	10346563	missense	probably benign	0.09
R5426:Adgb	UTSW	10	10350260	missense	probably benign	0.14
R5516:Adgb	UTSW	10	10431157	missense	probably damaging	1.00
R5554:Adgb	UTSW	10	10340473	missense	probably damaging	0.98
R5678:Adgb	UTSW	10	10431326	missense	possibly damaging	0.83
R5707:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5708:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10377847	nonsense	probably null
R5928:Adgb	UTSW	10	10378787	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10395352	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10450036	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10378026	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10431291	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10398943	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10422758	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10353080	splice site	probably null
R6383:Adgb	UTSW	10	10450028	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10377892	nonsense	probably null
R6639:Adgb	UTSW	10	10435956	missense	possibly damaging	0.51
R6697:Adgb	UTSW	10	10406126	nonsense	probably null
R6742:Adgb	UTSW	10	10411849	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10390197	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10394574	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10472241	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10400574	missense	possibly damaging	0.80
R7386:Adgb	UTSW	10	10377949	missense	possibly damaging	0.52
R7431:Adgb	UTSW	10	10391955	splice site	probably null
R7569:Adgb	UTSW	10	10431252	missense	probably benign
R7579:Adgb	UTSW	10	10410818	nonsense	probably null
R7582:Adgb	UTSW	10	10390821	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10436010	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10411712	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10339660	nonsense	probably null
R7808:Adgb	UTSW	10	10378659	splice site	probably null
R8158:Adgb	UTSW	10	10378734	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10350304	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10405284	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10357966	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10442688	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10340519	nonsense	probably null
R9386:Adgb	UTSW	10	10398964	missense	probably benign	0.00
R9777:Adgb	UTSW	10	10407470	missense	possibly damaging	0.74
X0003:Adgb	UTSW	10	10394630	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10378742	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- ATTGCTGGAAATCATGGAACTCC -3'
(R):5'- TGAGGTGGATCATCAGCGAAATC -3'

Sequencing Primer
(F):5'- GGAACTCCACCTTTAGTCTGG -3'
(R):5'- GTGGATCATCAGCGAAATCTATGCTG -3'

Posted On

2015-04-06