Incidental Mutation 'R3877:Olfr384'
ID276914
Institutional Source Beutler Lab
Gene Symbol Olfr384
Ensembl Gene ENSMUSG00000060335
Gene Nameolfactory receptor 384
SynonymsOlfr386, GA_x6K02T2P1NL-3739520-3740032, GA_x6K02T2P1NL-3773152-3774090, MOR135-5
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73598594-73605092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73603153 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 191 (D191V)
Ref Sequence ENSEMBL: ENSMUSP00000148997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072993] [ENSMUST00000214228]
Predicted Effect probably damaging
Transcript: ENSMUST00000072993
AA Change: D191V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072758
Gene: ENSMUSG00000060335
AA Change: D191V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.6e-9 PFAM
Pfam:7tm_1 41 290 1.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214228
AA Change: D191V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.5145 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P possibly damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Olfr384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Olfr384 APN 11 73603230 missense probably damaging 1.00
IGL01767:Olfr384 APN 11 73603032 missense probably benign
IGL02296:Olfr384 APN 11 73602706 missense probably damaging 1.00
IGL02327:Olfr384 APN 11 73603155 missense probably damaging 1.00
IGL02740:Olfr384 APN 11 73602831 missense probably benign 0.41
H8562:Olfr384 UTSW 11 73603447 missense probably damaging 1.00
R0594:Olfr384 UTSW 11 73603392 missense probably benign 0.03
R2038:Olfr384 UTSW 11 73603413 missense probably damaging 1.00
R2127:Olfr384 UTSW 11 73602805 missense possibly damaging 0.78
R2844:Olfr384 UTSW 11 73603383 missense probably benign 0.12
R2846:Olfr384 UTSW 11 73603383 missense probably benign 0.12
R4193:Olfr384 UTSW 11 73603417 missense probably damaging 1.00
R4433:Olfr384 UTSW 11 73602886 missense probably damaging 1.00
R4824:Olfr384 UTSW 11 73602600 missense possibly damaging 0.61
R4851:Olfr384 UTSW 11 73603057 missense probably damaging 1.00
R5285:Olfr384 UTSW 11 73602941 nonsense probably null
R5326:Olfr384 UTSW 11 73603204 missense possibly damaging 0.94
R5542:Olfr384 UTSW 11 73603204 missense possibly damaging 0.94
R5662:Olfr384 UTSW 11 73603179 missense probably benign 0.03
R6489:Olfr384 UTSW 11 73603439 missense probably damaging 1.00
R6770:Olfr384 UTSW 11 73602978 missense probably benign 0.04
R7131:Olfr384 UTSW 11 73602736 missense possibly damaging 0.78
R7313:Olfr384 UTSW 11 73602984 missense probably damaging 0.99
R7754:Olfr384 UTSW 11 73603506 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTATGTGGCCATCTGCTTC -3'
(R):5'- AATTGTCCCATAGAACAGTGAGACC -3'

Sequencing Primer
(F):5'- TCTTCATTACACCAGCATCATGAG -3'
(R):5'- CAGTGAGACCACAGACAGGTG -3'
Posted On2015-04-06