Mutagenetix > Incidental Mutations

Incidental Mutation 'R3878:Trim33'

276936

Institutional Source

Beutler Lab

Gene Symbol

Trim33

Ensembl Gene

ENSMUSG00000033014

Gene Name

tripartite motif-containing 33

Synonyms

ectodermin, Ecto, 8030451N04Rik, Tif1g

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3878 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103279293-103358775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103352005 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 1003 (I1003M)

Ref Sequence

ENSEMBL: ENSMUSP00000102473 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029444] [ENSMUST00000106860] [ENSMUST00000198706]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029444
AA Change: I1003M

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029444
Gene: ENSMUSG00000033014
AA Change: I1003M

Domain	Start	End	E-Value	Type
low complexity region	6	31	N/A	INTRINSIC
low complexity region	33	134	N/A	INTRINSIC
PHD	138	199	9.85e0	SMART
RING	139	198	2.12e-8	SMART
BBOX	226	273	1.24e-9	SMART
RING	231	293	2.01e0	SMART
BBOX	285	326	1.54e-10	SMART
BBC	333	459	7.55e-45	SMART
low complexity region	540	583	N/A	INTRINSIC
low complexity region	731	773	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
PHD	902	945	4.15e-11	SMART
BROMO	972	1095	3.74e-30	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106860
AA Change: I1003M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000102473
Gene: ENSMUSG00000033014
AA Change: I1003M

Domain	Start	End	E-Value	Type
low complexity region	6	31	N/A	INTRINSIC
low complexity region	33	134	N/A	INTRINSIC
PHD	138	199	9.85e0	SMART
RING	139	198	2.12e-8	SMART
BBOX	226	273	1.24e-9	SMART
RING	231	293	2.01e0	SMART
BBOX	285	326	1.54e-10	SMART
BBC	333	459	7.55e-45	SMART
low complexity region	540	583	N/A	INTRINSIC
low complexity region	731	773	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
PHD	902	945	4.15e-11	SMART
BROMO	972	1078	3.52e-35	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000197365
AA Change: I196M

Predicted Effect

probably benign
Transcript: ENSMUST00000198706

SMART Domains

Protein: ENSMUSP00000142585
Gene: ENSMUSG00000033014

Domain	Start	End	E-Value	Type
Blast:BBC	1	30	9e-11	BLAST
low complexity region	111	154	N/A	INTRINSIC
low complexity region	302	344	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E9.5 with abnormal embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020A23Rik	C	T	2: 130,405,640	T32M	probably benign	Het
4930402H24Rik	T	C	2: 130,778,503	R237G	possibly damaging	Het
A2ml1	T	C	6: 128,554,361	S915G	probably benign	Het
Ablim1	T	C	19: 57,037,210		probably null	Het
Cadm2	C	T	16: 66,815,441	E78K	probably damaging	Het
Ceacam5	C	T	7: 17,750,581	P416L	probably damaging	Het
Chsy3	T	C	18: 59,409,773	F661S	probably damaging	Het
Clstn3	G	A	6: 124,457,942	T338I	probably damaging	Het
Ctif	A	G	18: 75,519,977	I403T	probably damaging	Het
Eprs	T	A	1: 185,415,953		probably null	Het
Fam214b	T	G	4: 43,035,867	H288P	probably damaging	Het
Frs2	A	C	10: 117,078,910	S35A	probably benign	Het
Gpr155	C	T	2: 73,368,392	W394*	probably null	Het
Ift140	G	A	17: 25,028,944	V259M	probably benign	Het
Igkv9-124	A	T	6: 67,942,207	S74T	probably benign	Het
Krt14	C	T	11: 100,207,089	V123M	possibly damaging	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Nebl	T	C	2: 17,393,252	T457A	possibly damaging	Het
Nlrp4g	A	G	9: 124,349,362		noncoding transcript	Het
Nsa2	C	G	13: 97,132,034	G175A	probably benign	Het
Olfr1090	T	C	2: 86,754,628	T37A	probably benign	Het
Pax1	A	T	2: 147,362,308		probably benign	Het
Pdzd2	T	C	15: 12,376,176	E1291G	probably benign	Het
Relb	G	A	7: 19,617,844	H115Y	probably damaging	Het
Rnase10	A	G	14: 51,009,432	E52G	probably damaging	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Slc14a2	C	T	18: 78,159,074	V614I	probably benign	Het
Slc20a2	T	C	8: 22,568,383	L645P	possibly damaging	Het
Smoc2	A	G	17: 14,325,617	D56G	probably damaging	Het
Szt2	A	G	4: 118,390,585	S789P	probably damaging	Het
Tenm2	A	G	11: 36,139,574		probably null	Het
Tm9sf3	A	G	19: 41,246,713	V169A	probably damaging	Het
Trbv13-1	C	T	6: 41,116,388	T86I	probably benign	Het
Trim24	A	G	6: 37,964,773	D886G	probably benign	Het
Trim37	T	C	11: 87,206,002	V777A	probably benign	Het
Ttc7	A	C	17: 87,370,738		probably benign	Het
Ttn	T	C	2: 76,766,020	D11856G	possibly damaging	Het
Vmn1r226	A	T	17: 20,687,998	D164V	possibly damaging	Het
Vmn1r34	G	A	6: 66,637,568	T62I	possibly damaging	Het
Wapl	T	C	14: 34,692,147	L322P	probably damaging	Het
Zfp62	A	G	11: 49,215,133	D17G	probably damaging	Het

Other mutations in Trim33

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Trim33	APN	3	103330182	missense	probably benign	0.44
IGL00981:Trim33	APN	3	103351995	splice site	probably benign
IGL01010:Trim33	APN	3	103346715	nonsense	probably null
IGL01025:Trim33	APN	3	103353918	utr 3 prime	probably benign
IGL01082:Trim33	APN	3	103326859	missense	possibly damaging	0.49
IGL02245:Trim33	APN	3	103346770	critical splice donor site	probably null
IGL02291:Trim33	APN	3	103326865	missense	probably damaging	1.00
IGL03248:Trim33	APN	3	103310973	unclassified	probably benign
IGL03400:Trim33	APN	3	103329143	missense	probably damaging	0.99
abilene	UTSW	3	103321559	missense	probably damaging	0.99
Bemoaned	UTSW	3	103326793	missense	possibly damaging	0.92
Excision	UTSW	3	103344576	missense	probably damaging	1.00
Peaked	UTSW	3	103337532	critical splice donor site	probably null
Pike	UTSW	3	103310885	missense	probably damaging	0.98
westworld	UTSW	3	103326901	missense	possibly damaging	0.46
R0143:Trim33	UTSW	3	103352101	missense	probably benign	0.00
R0471:Trim33	UTSW	3	103326901	missense	possibly damaging	0.46
R0513:Trim33	UTSW	3	103310384	missense	probably damaging	1.00
R0573:Trim33	UTSW	3	103351990	splice site	probably benign
R0586:Trim33	UTSW	3	103310344	missense	probably damaging	0.99
R1103:Trim33	UTSW	3	103310885	missense	probably damaging	0.98
R1157:Trim33	UTSW	3	103353830	missense	probably damaging	1.00
R1328:Trim33	UTSW	3	103353597	missense	possibly damaging	0.86
R1331:Trim33	UTSW	3	103310354	missense	probably damaging	0.99
R1385:Trim33	UTSW	3	103310950	missense	possibly damaging	0.46
R1397:Trim33	UTSW	3	103310434	unclassified	probably benign
R1785:Trim33	UTSW	3	103329220	frame shift	probably null
R1848:Trim33	UTSW	3	103324640	unclassified	probably benign
R1903:Trim33	UTSW	3	103337444	missense	probably damaging	1.00
R3404:Trim33	UTSW	3	103321559	missense	probably damaging	0.99
R4156:Trim33	UTSW	3	103310314	missense	possibly damaging	0.94
R4281:Trim33	UTSW	3	103329086	missense	probably damaging	0.99
R4570:Trim33	UTSW	3	103330165	missense	probably damaging	0.96
R4809:Trim33	UTSW	3	103329256	missense	possibly damaging	0.91
R4904:Trim33	UTSW	3	103331647	missense	possibly damaging	0.46
R5168:Trim33	UTSW	3	103341681	nonsense	probably null
R5458:Trim33	UTSW	3	103330180	missense	possibly damaging	0.64
R5910:Trim33	UTSW	3	103344576	missense	probably damaging	1.00
R6195:Trim33	UTSW	3	103337532	critical splice donor site	probably null
R6331:Trim33	UTSW	3	103341609	missense	probably benign	0.00
R6636:Trim33	UTSW	3	103353719	missense	probably damaging	1.00
R6642:Trim33	UTSW	3	103337514	missense	probably damaging	0.99
R6783:Trim33	UTSW	3	103352087	missense	probably damaging	1.00
R6856:Trim33	UTSW	3	103352049	missense	probably damaging	0.97
R7220:Trim33	UTSW	3	103326793	missense	possibly damaging	0.92
R7325:Trim33	UTSW	3	103321636	missense	possibly damaging	0.93
R7374:Trim33	UTSW	3	103310323	missense	probably damaging	0.98
R7430:Trim33	UTSW	3	103310903	missense	possibly damaging	0.92
R7491:Trim33	UTSW	3	103326148	missense	probably benign	0.28
RF005:Trim33	UTSW	3	103280212	frame shift	probably null
RF007:Trim33	UTSW	3	103280217	small deletion	probably benign
RF014:Trim33	UTSW	3	103329092	missense	possibly damaging	0.94
RF061:Trim33	UTSW	3	103280217	small deletion	probably benign
RF064:Trim33	UTSW	3	103280195	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGCATGTATCCTGCAGTAAGATCTG -3'
(R):5'- GCCAATACTCTATAGGTTGGAAGC -3'

Sequencing Primer
(F):5'- CCTGCAGTAAGATCTGATAGTCAAG -3'
(R):5'- ACTCTATAGGTTGGAAGCTAACATAC -3'

Posted On

2015-04-06